Microarray Probes on PGSC0003DMT400049998

Probe IDChipProbe Sequence
CUST_17239_PI426222305 JHI_St_60k_v1 AAGAGAAACAGAGAGCAAAACTTGCAATTTCTGGGGTGAAGAAAATGGCTACACTGAGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049998

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049998 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G38760.1 +2 2e-134 392 192/321 (60%) annexin 3 | chr2:16201086-16202490 FORWARD LENGTH=321

Transcript Sequence (1177 bp)

>PGSC0003DMT400049998 1177 pgsc_dm_v3.4
GGGAAAAATAACTGAAAGTGTTAAAGAGAAACAGAGAGCAAAACTTGCAATTTCTGGGGT
GAAGAAAATGGCTACACTGAGAATCCCAGATGTTGTTCCTTCTCCAGATGAAGACTGTGA
AACTCTTATGAAATCCTTCAAAGGACTGGGAACTAATGAGAAGTCAGTGATATCGGTGTT
GGGCCAGAGAAATGCAAGCCAGAGGAAGAAGATCAGAGAAACCTATCAGCAACTTTACAA
CAAGTCCCTTATAGATGACATTAATTCTGAATTGTCTGGTGATTTCAGGAAAGCAGTCAT
CCTATGGACATACGAGCCTTCTGAAAGAGATGCACGGCTAGCAAATGGAGCCTTAAAGTC
AAGAAAGAAAACCATCACCCAGTTGCAAGTGATAGTAGAGATAGCTTGTGCATCATCTCC
TGATCATCTGGTCGCGGTGAGACAAGCATATTGTGGCCTTTTCAACCGTTCACTTGAAGA
AGATATCACAGCAAATGTCCCTATGCCTATACAAAAGATTCTTATTGGTCTAGTCAGGTC
CTATCGATATGATAAAGAATTGGTGGATCCTAGTACTGCAAATGAAGAAGCTGCTATCCT
TCGTGAAGCCATACGGACAAAACAGTTGGATCATGACAATTTTCTTTTCATACTCAGCAC
AAGGAGTAGTTGTCAGCTTAGAGCAACTTTTGAGTGCTACAAGCAAAATTATGGATTCTC
CATTGACCAGGACATTAAGAGCTGTGGAAAAGGTCTATTGGAATCTATCCTGAAGGTGGT
TATCTGGTGTATTGATTCGCCAGAGAAACATTTTGCTGAGGTTGTCAGAGCCTCGATTGT
CGGTTTTGGAACTGATGAGGATTCTCTAACGAGAGCCATTGTAACTCGAGCTGAAGTTGA
TATGATGAAAGTAAGGGGAGAATATATCATAGCGAACAAAACTAGTCTTGATAATGCAGT
TATTGATGACACATCAGGTGATTACAGAAAATTCCTCATGACACTGCTTGGTGCCAAAGT
GTAGACCTGACCATTATCTTGTTGTGTTTCAATACTATGCTACTACTTTGTATGATTTAT
TCGGAAATGCTATATGCGCATTATTGGGGTGGTTTTGCAGTGAAATGTTTAATAATTGGA
GAGTGAATTTGTATATAAGTTTGTGGTTTGTCACTTG