Microarray Probes on PGSC0003DMT400049671

Probe IDChipProbe Sequence
CUST_37680_PI426222305 JHI_St_60k_v1 GCTATTGTTTGTTGCTTCTGCGGGGCTGTTCTCAAATCTTACAGATAATAATAACAATAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049671

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049671 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G52855.1 +3 8e-35 118 46/68 (68%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15534.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | chr1:19683137-19683343 REVERSE LENGTH=68

Transcript Sequence (398 bp)

>PGSC0003DMT400049671 398 pgsc_dm_v3.4
CAACAATTACGTTTCTTGGTGGAAAAGTTGCTAAATTCTCTACTTCTCTAATTTGATCGA
TCGATACAATATAATACGATACGATGGTTTGTTTTTGCTTTTTGGTGGATCAGAAGAAGA
TGATGAGGCAGAGTAAGCCCGTGGCCGGTTCGTGTTCACGTTGCGGCCACGGAGCTCAAG
TTGCTCATATGCGGACCGCTACCAGATTTTGTTACGTTCCATTTTACTGGAAATCTTGGA
AGGCTATTGTTTGTTGCTTCTGCGGGGCTGTTCTCAAATCTTACAGATAATAATAACAAT
AATATATATGAACCTATATATAGTAGCTATAATATAGAAACTCAGAACTATATATATAAG
TTCTCGAGCCATCAAGATAAAAATTCTAACTTCGCAAC