Microarray Probes on PGSC0003DMT400049665

Probe IDChipProbe Sequence
CUST_37647_PI426222305 JHI_St_60k_v1 CATGATTATTGAGGTGGAAAGGGCATTTATTCTTTGGTTGGCGACTAAAATAGCAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049665

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049665 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G27410.3 +3 4e-119 356 185/277 (67%) NAC (No Apical Meristem) domain transcriptional regulator superfamily protein | chr4:13707928-13709013 REVERSE LENGTH=314

Transcript Sequence (1485 bp)

>PGSC0003DMT400049665 1485 pgsc_dm_v3.4
CACAATTTAAGAAATTTCAGAGAATCAAAATTTATCTTCTCTCCAATTTCCTAAAAACTT
GCAACGCTTTTCTTCTCTCTCTACATTTTGCTTACTTGTAAGAAAAAATGGGTGTTCAGG
AAATGGATCCTCTTACACAGCTAAGCTTGCCACCCGGGTTTCGGTTTTACCCGACTGATG
AAGAGCTTTTAGTTCAATATTTATGCCGTAAAGTTGCTGGTCATGATTTTTCTCTGCAAA
TTATTGCTGAAATTGATTTGTACAAATTCGATCCATGGGTTCTTCCAAGTAAGGCGATTT
TTGGAGAAAAAGAATGGTATTTCTTCAGTCCAAGAGATCGGAAGTATCCAAATGGATCTA
GACCGAACAGAGTAGCTGGTTCTGGTTATTGGAAAGCAACTGGAACTGATAAAATAATTA
CTACGGAAGGTAGAAAAGTTGGAATCAAAAAGGCTTTAGTGTTTTATATTGGTAAAGCAC
CTAAAGGAACTAAAACGAATTGGATTATGCATGAATACAGACTCAGCGAACCTACAACGA
AAAGTGGAAGTTCAAGGCTCGACGATTGGGTTCTATGTAGGATTTACAAGAAGAATTCCG
GTGGGCAAAAACCGAGTTGTTCTGATTTACAGAGCAAGGATATAAACCATGGTTCATCAT
CGTCATCCTCGTCTCAATTTGACGATATGCTGGAATCTCTACCAGCAATTGAAGATCGAT
ATTTCTCATTACCTAAAGTGAATTCCATTAGGAATTTTCAACAAGACGAAAAGCTCAATC
TTCAACAATTGGGTTCTGGGAACTTTGATTGGGCCACTATAGCGGGATTGAACTCATTTC
CGGAATTAGCTTCCGGAAATCAAGTTCCAGCACCGGGTAATCAAACTCCGGTGCTTATGA
ACACAAATCAGTATCACAATCACAACAACAATTTGAATAATTTCAATGAATTTTTCGCCA
ATTCAACGGCGTTAAATTTTCACAGCGAAGTTAAGTTTGAAGGAGGAGTTGATCAAGAAG
TAGAAAGCAGTGTTAGAGCTCAACGACTTAACAGCGTTAACCCGGGTTTCTTCCAAGAGA
ACTCAACCGGGTTTCCGAGTTCTTATACGAATTCGGTGCCCGACCCGTTTGGGATTCGGT
ACCCGACCCAAACAGTAAATATGGGTTTTACTGGGTAAATAGTGGAAGGGTAAAATGTGA
ATGCTCATAGATTAACTTGAAGACAATTTGGAAAAAATTGTCATGATTATTGAGGTGGAA
AGGGCATTTATTCTTTGGTTGGCGACTAAAATAGCAAAAAAAAAAAAAAAAAAGTTAACA
AGATTTTGTTCATGCAATTATGCACATATACAATGTATTTTGTTGTACTAAAATTTAAGG
CTTTGGTAATGGTACTTATAGGAATACAAATTGGAGGATTTGATTAGCTAATTTTATTTT
GTTGTTGTAAACTTTTAAGACCTTAACGCGAATTTGTTGTTTTCT