Microarray Probes on PGSC0003DMT400049654

Probe IDChipProbe Sequence
CUST_37644_PI426222305 JHI_St_60k_v1 GTGAGTGTTAACATTAGCACTGAATCCTTTCATTCTGAGGCAATGAATACTTCATTTGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049654

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049654 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G21570.1 +1 1e-133 403 198/274 (72%) Protein of unknown function (DUF300) | chr4:11471126-11472269 REVERSE LENGTH=294

Transcript Sequence (2480 bp)

>PGSC0003DMT400049654 2480 pgsc_dm_v3.4
ATTATGTATTTATTAGGATTATCCATAAAAAGTCATTTATGTAGAGATTTAACTTGTTTA
GATTACAATATTGTTGAAAGATCAAATTTTTACCTTTCTTTAAAATGTTGTTTCTGTTCA
TTAGTGCAGCAGCTGGATCCTTGATGTTTTTTTCTTGGGTGAATCTTGAAATATCCATGA
CTGTGTTATAGCCTAGCTAGTTTCCATTTAGCTTGTTTGAGTCCAAATTGACCTTGTAAT
TTGTAAAGGGTTTGTCTTTTTAATGATTTTAAGGTCATAAAAATACAAGGTCAACTGTTG
AGGAATCTAGAGGTGAGGCAGAGTGATTTAGCTTAGTTTGTAATTTCATCTTGTTCTTGG
GCAAAAGACCCAAAAGTTGCACACTGAACCACACACGGTTAGCTAAAATATCATCCATAC
TTGTGGGATTACACTGGTAGGTAGGATGCGTGCATCCTACCCCGACCCCACTTATGGGAC
TACACGGGGCATGTTGTTTTGTTGTTGTACTAGTGATACTATGATACTTTGGATTCCTCA
TATTTCTCGTTGTAGTTAGGACTAAGTGTTGATGTCGATAAGTACTCTTTTCTTTTAACC
TTTCCACTTACCTTAACTCTATCTTGAACTAACTAACAGATTTGTTCTATTACTGTTAGC
ATGTAAATAAGAAGATTTTTTTATGGTAATTTATCATTGATTGGGTACCAATTAAGAACT
GCGAGCACTATTAAGTCATGGTTCACCAGATGGCTTAGTTTAGATTGATTGGTTAACGGA
GCTATATCCAATTATTGACCCAAAATGGGATGGATTGAGAACATTGAGTGCCTTTGAAGG
GTTAGTTTAGGTCATGAATGAGTCAATCTGCCTTTCTAGTTAGAACATTAAGTTGAAGAC
CGAAGACAAAGCTGGGTTGTGTTCGGAATTATAACTTTTCAGATTATGAAAGATGGTATA
ATTGGGTTAAAAAACTGACTGGTATGAGAAGTCAGTGTTACAGATTTGTCATTTGGGTTT
CTTAATTGTTGCAAGTGGAAGTGGTGATATATCCTGATGGTTGACATGAGGAGTGAAGGT
CGAGGAATAGAAATGAAATTTGGTGGATTGAATTAAATAATGGTGGTAATCTACATAAAT
CAGTAGATATATTGTACACAAATGAATTTTGGGTAACAATGAAAGTTGTACTTCTGTATA
TCAATGAAATTCTTGTCTATTTTATTTCCCTACATTTCTCTTGAAAATTCAGTCCTGATA
AGTCTTAACACCACTGTGCAGGTTTGATTTTGGTATTCTTGTTGGCTAACAACAAATATG
GAATTGGATCTGGATCGTGGGCAAGTCACACTGATAGTATCCAGTATATGTCTTATGCTG
ACTTTGCATTTCAGCATACAGCTAGTGACAGAACATTTTACGTCATGGAAGAAGCCTAAA
GAGCAAAAGGCAATAATTATTATCGTCCTCATGGCACCCTTGTATGCTATTGTCTCCTTC
ATTGGGTTGGTCGATTTCATGGGAAGCAAACCCTTTTTCACTTTCTTGGAATCTGTCAAA
GAATGTTATGAAGCAATTGTGATGGCTAAGTTTCTGGGGTTGATGTACACTTACTTGAAT
ATATCCATAAGCAAAAACATAGTCCCTGATGAAATTAAGGGAAGACAGATTCACCACTCA
TTCCCAATGACACTCTTCCAGCCTCACACTGCTCATTTGAACCATCATACATTGAAGCTT
CTCAAGAACTGGACATGGCAGTTTGTTGTGATTCGCCCTGTATGCTCCATCTTGATGGTT
GTTTTACAAATGCTTGGAGTGTACCCTAGTTGGGTTAGCTGGACCTTTACCATCATTTTG
AACATATCCGTTTCACTGGCGTTGTACTCTCTTGTGGTTTTCTACCACGTGTTTGCGAAG
GAGTTGGCGCCTCACAAGCCTCTAGCCAAGTTCCTGTGTGTCAAAGGAATTGTCTTTTTC
GTTTTCTGGCAGGGTATTCTGCTTAGTACTCTGGTATCACTAGGCATAATAAAATCTCAC
TATTTCTGGCTTGAGGTGGAGCGCCTTCAGGAAGGTATGCAGAATGAACTAGTGATCGTG
GAGATGGTTTTCTTTGCTATCCTTATGCGTCATGCATACAGTGCAGCGCCATATCGCGCA
GAAGCTGTTACAACTACGTCAGGAGATGCTACTTCAGGAGATAAAAAGAATGAGTGATTA
TGCAACATGTATTGTTGTGAAAAATTATCTTCAGACATCAGTCAACTTCTCCCTACTGTT
TGTGTGTTATATTGGATTTACTTGTTTGAAGTATACCAGATTCCTATTACAGATCAACTA
GAACATTTTGTGAGTGTTAACATTAGCACTGAATCCTTTCATTCTGAGGCAATGAATACT
TCATTTGAAATAAAATAGAGAAGCATATGAGCAGTTGGTTCTTTTTTTTTTGTCTTCAAT
ATAATTACAGTATTATTTTT