Microarray Probes on PGSC0003DMT400049641

Probe IDChipProbe Sequence
CUST_37641_PI426222305 JHI_St_60k_v1 GTATATAGGTTGTGTGAGACTGTTCATGTTAGATTCTTCATCCTTTTCTTCTTCTTACTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049641

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049641 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G27350.1 +2 4e-114 340 162/284 (57%) Protein of unknown function (DUF1223) | chr4:13690979-13692621 REVERSE LENGTH=278

Transcript Sequence (1313 bp)

>PGSC0003DMT400049641 1313 pgsc_dm_v3.4
TTTTCCTCTCCACCATCTCTTCGTATTTTTACTATTCTAAGCTTTCCATTTTCATTTCTC
ATTTTTTTTCTTCAGTTCGAAAACCCCATTAAAACATTGTTTAATTTCTGAGAAATATAT
TCCATTACAATTTTCTCCATTAAAGCTTTAACGAATCACCAGGTTTGAGACGACTCGTCG
GAAAATGGGGCGCCGTCTCTTCACCTGCTTCGGCAAAGGCGGTTCTTCTCAATCTTCTTC
GAAAGATCCCAGCTCAAGTAATAACGACAGTGCGACGGCGGATTTAACGGCGGAGGAGCA
AAAACGGTGCGGGCCGGTGGTGGTGGAGTTATTCTCATCACAAGGCTGCGCCACCTCACC
TGAGGCGGAGCTATTGTTTTCGAGGATTGGGAGAGGCGATTTTAACCTAGAAATGCCGGT
GATTTTGTTGGCTTATCATGTGGATTATTGGGATTATATGGGTTGGAAGGATCCATTTGG
GTCGAGTTTATGGACGGTTAAACAAAAAGCGTATGTTGAGGCCTTAAATCTAGATACTAT
GTTTACGCCTCAAATTGTGGTTCAGGGACGAGCTCAATGTGTTGGGAATGAACAAGATGC
TGTTTTCTCTTGTATCAATTCTGCTCCCAGATTTGCTGCTCCTTCATTCCAGGCGACATT
CGAGAGGCCAACACCAGAGTCGTTGCAAGTATCTCTATTAGGATCTCTGAGGAGTAAGGT
GGACAATGATGGTGCCAACGTGATGATTGCTCTGTACGAAGGTGGTCTGGTCACTGATAT
CGCTGCAGGAGAGAACAAAGGAAAAATGCTTGCGAATGACTATGTTGTCAGGAGGCTGGA
TAAGCTTTGCTCTGTAAAGGATATTACTGCAAAGAAGACAATCTCAGGAACTGTCAACTT
CTCTCTTTGGGATGGCTTCAATAGCAGCAAATGTGGCGTAACGCTCTTTGTGGAAACTGG
CTCTCATCAAATATGTGGATCACAAAACTTTAAATTGCCGGAAAATCTCTGAATTCTTGG
ATGATATATCACTGATTGAAACTCTTGATGTGCTGGTTATAGGTTGGATTGCTTGTAGTG
CACGTCTCTGATTAAAATCAAATCTGCAAAACATTCTATATACCAGCTTGTTCCTTGTGT
ATATAGGTTGTGTGAGACTGTTCATGTTAGATTCTTCATCCTTTTCTTCTTCTTACTGTT
CATTCCTTTGCTTTTTTTATAAACGGTTTGACATATAGTGATTCTTTCCTTGTACTATGT
AATTGGATTATTAGAAATTGCGGCTAGAGATATTTTAGTGTAAATGCTTTTCC