Microarray Probes on PGSC0003DMT400049622

Probe IDChipProbe Sequence
CUST_37657_PI426222305 JHI_St_60k_v1 CATCCTTGTCGATTGTGAGTGTCATTCATTTCTCAGAATTGTATTAAAATCCTCCCTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049622

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049622 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G21380.1 +3 0.0 395 226/483 (47%) receptor kinase 3 | chr4:11389219-11393090 REVERSE LENGTH=850

Transcript Sequence (3037 bp)

>PGSC0003DMT400049622 3037 pgsc_dm_v3.4
AAAAAATGAAGTCTTGGTAATCTCTGAGACAATCTTACTGAAAAGAATACCACAAGAGAT
GGAATATGTTAAATTCTTTTTAACAATTTTGAAGAAGAATGCAATGCAACAAAAGGTAAA
TATAACTATCATGGATATAACAATATTTCAATTTATTCTACTTCTCTTGTATTTTGTGTT
TCTTCAAAATGTTAGTGGTCAAGGAGATACCATAACTACAACTCAATTCATTAAACATGG
TGATACTATTGTTTCGTCTCATGGAACGTTCGAGTTAGGATTCTTCAGTCCTGGAGATAC
TTCTACAAATCACTATGTTGGAATATGGTACAAGAAAACCTCTGCTACTACTCCTGTTTG
GGTTGCCAATAGACTAGCTCCTGTTGCTAATAAGTATGGGGTGTTGAAAGTTATTCAGCC
AGGTCTGATTGTACTTCTGAATGATACTAATGCAACTGTTTGGTCCACAAACTCATCGAA
ATCTGTACAGAATCCTGTTGCTCAGTTGTTGGACACAGGGAATTTTGTGGTGAGGGATGC
TAATGATCCGAATCCAGAGAATTTCCTCTGGCAAAGTTTTGATTATCCTAGTGATACGTT
GTTGGAAGGTATGAAACTTGGGACGGACTTGGTGACTGGATTAGAAAGGTATCTTACTTC
TTGGAGAAGTAGTGATGATCCTGCTCCGGGGGATTATACTTATCATTGTGATCCTACGGG
TTATCCACAAAACCTTATGCGAAAAGGGGCTAATGTGACGTTTAGAGCAGGGCCGTGGAA
TGGTATCAGGTGGAGTGGTGCACCAAATCTGGTAAACAACTCTATCATTTCTTTTGGCAT
GGTTATGAATAGTAGGGAAATTTACTACAAGTATGAGATGGTGAACAAATCCGTTATTTC
AACATTTGTTTTAGAGCCTTATGGGAAAGCTATGCGTATCATTTGGATTGGAAAGGTTCA
GGGATGGGTAAATTACCACTCTGCAGTTGTGGATGACTGTGACACCTACAAATTATGTGG
TGCATATGGGACTTGCAACATTTTGAGTGATCCTTTTTGTCAATGTTTAGATAATTCGAG
CCAAAACATCCTGATAATTGGGAAAGGTCTGACTGGTCTAGTGGTTGTGTCCGGAAGATC
CCACTGAATTGCACAGGAGATGGATTTATTAAGTATTCTGGTGTTAAACTGCCTGATACG
CGAAATTCTTGGTTCAATGAGACAATGACACTAGATGAATGCAGGGTAGTTTGCTTGAGA
AATTGTTCGTGTACGGGTTATACTAATCTGGATATACGCAAGGAGGAAGGGGGTGCTTGC
TATGGATTTGGGAGCTGGTTGACATCAGACAGCTACCTGCATCAGGACAGGATATCTACA
TTAGGATGTCTGCTTCAGACATAGGTTCTGCTGGATCAAAAGGAAAGATAGCTTTCATAC
TTGCAATAGCTTTGCCACTATTGGTTGCATTGATTCTGCTTGGTTTAGGTGTAGGCCTGA
TTCTTTGTAAACGAAAAAGGAGAAAGGATCCGGTGGTTACAACAACAGGGAGATTAGGTG
GTCACAGCAACAAGAATGATAACAGTAATCAAATTCACGAGGAAAATTTTGAGCTTCCAC
TTTTTGACTTATTAACGTTAACCAATGCTACCAACAACTTTTCATTTGCAAACAAGATTG
GAGAGGGTGGCTTTGGACAAGTTTACAAGGGTGTATTAGAAGGTGGACAAGAAGTAGCAG
TGAAGCGGCTTTCAGAAACATCAGAGCAAGGACTTCACGAGTTCAAGAATGAAGTTAAGT
GCATCGCAAAACTTCAGCATCGGAATCTTGTAAAGCTTCTAGGATGCTGCATTCAAGGAG
AAGAGAAGATGCTGGTGTATGAGTACTTGCCAAACAAAAGCCTGGAATTATATATATTTG
ATGAAGAAAGGAGTGCATTACTTGATTGGCCTAAGCGCTTCAATATTATCAATGGAATTG
CTCGAGGACTGATGTATCTTCATCAAGATTCTAGGCTCAGAATCATCCACAGAGACTTGA
AAGCTAGCAATGTCTTACTTGATATTGAAATGAATCCAAAAATATCCGATTTTGGGATGG
CTAGAAGTTTCAGAGGAGATGAGACAGGAGACAATACAAGCCGTGTTGTTGGAACATAGT
AAGATTTAATATTTGATTATATATGTAGTCATGAACACATGGTGCATTATATAATCCTGT
AGTTTCTTTATTGCAGTGGTTACATGTCCCCGGAATATGCAGTCGAGGGGATATTCTCAG
TGAAATCAGATGTCTTTAGCTTTGGGGTATTAGTACTAGAGATTGTGAGTGGAAAGAAGA
ACCGACGATTTGTTCATCCAGACCACCACTTCAACCTTCTTGGACATGCATGGATGCTTC
ATAATGAAGAACGGACGTTGGAACTAGTAGATCCATATCTCGTAAATTCATACTATATAT
CAGAAGTACTAAGATCAGTCCATGTGGGATTGTTATGTGTTCAACAGAATCCAGAGGACA
GGCCAAGCATGTCAACTGTGATTATGATGCTGAGCAATGAAGGCATTTTACCACTGCCTA
AACATCCCGGTTTCTTCACTGAAAGGAAAGTTGAAGGTCATGATCAATTATCTTGGAGTA
CACAAACACCAAGTTCTATAAACGAAGTTACCATCACGCTGTTGAATGCTCGATAGAAGC
ATATCATGGCCATAGTCAGTGGCAAAGCCAGGATTTTCACTAAGGGTTTCAAAATATGAA
AGAAGTAAACACACAAAGTCAAGACGATTCAACAACTATTATATATACATAAACAATTAA
TTGTAGACCTTTATATATATAGTGTAATTTTTTGGCGAAAGGGTTCGGATGAACCCCTTG
CATCAACTTGGCTCCATCCTTGTCGATTGTGAGTGTCATTCATTTCTCAGAATTGTATTA
AAATCCTCCCTTTTTTTCTTTAAGAAATTAGAAAGCAAAATCTGCAGGAATTGTATTGAA
ATATGTCTAAATTTTAAGGCTTTGAATTCAATTTCAG