Microarray Probes on PGSC0003DMT400049549

Probe IDChipProbe Sequence
CUST_37625_PI426222305 JHI_St_60k_v1 GTTACATTATTTTCTTCCAAGGAACGGAGTTAGGGTTGGGGTGTATAGTAACCTGAATTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049549

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049549 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G27360.1 +1 2e-36 126 72/91 (79%) Dynein light chain type 1 family protein | chr4:13694032-13694517 FORWARD LENGTH=103

Transcript Sequence (673 bp)

>PGSC0003DMT400049549 673 pgsc_dm_v3.4
TAGAAAATAGAAAATGATATAAACACAAAAAGAGAAAAAGTGAAAAAGAAAGGCAAAAAA
TAAAATTAAAAAAATCACACTTTTTTTGGAAAATAATTTTTTTTGAAGATGTTGGAAGGG
AAAGCAGTAATTGGAGACACAGATATGTTGGGAACCATGCAACAAGATGCATTAGATTTA
GCTGCAAAGGCACTTGACTTCTTTGATGTCACTGAGGCCACTGAAATTGCACGTTTTCTT
AAAAAGGAATTTGATACGATGTATGGACCAGGGTGGCAATGCATAGTAGGGACAGATTTT
GGTTCATTTGTAACACATTGCTATGGTTGTTTCATCCATTTCTATATTGGCAGCCTTGCT
ATTTTGCTCTTCAAGGGCTCTGCTGCCCTAGAGGACCCGAAAGCCGAGGCCGAGGCTGAA
GCTGACCGGTTTTCCATCTCTCCAGGAAATAGCGTGAAGTCACTTCTTCAATAATTTTAC
CGTTGTCAACCAAGGCATATATATACACTCCAATGTACAATATTAGGAAGTTTCAAAGTC
TTAATTTCACATTTATATTATCACATCTATAAGTTATATATGTCAATTCGATCGCTTTCC
TTTTTTCGGTGTTACATTATTTTCTTCCAAGGAACGGAGTTAGGGTTGGGGTGTATAGTA
ACCTGAATTCAGC