Microarray Probes on PGSC0003DMT400049495

Probe IDChipProbe Sequence
CUST_37655_PI426222305 JHI_St_60k_v1 TATGCCTAGTCATAACAAGGCAAGCTTGAAATTGTGCTCTATGGCGAGTGGTGGGTGAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049495

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049495 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G20660.1 +2 0.0 523 266/383 (69%) organic cation/carnitine transporter4 | chr3:7225271-7228510 REVERSE LENGTH=526

Transcript Sequence (1450 bp)

>PGSC0003DMT400049495 1450 pgsc_dm_v3.4
ATTATTTCCAGGTGCTGGAGTATTTGGACATTTATCAGATTCCAAATTGGGAAGAAAAGG
CTCTTTAACTATAGTTTGCATTATGAATGCAATCTTTGGTTGTTTAACTGCAATTTCTTC
GGATTACTGGACTTATACCTTATTCCGCTTTCTCTCCGGTTTCAGCACCGGCGGGACTGG
CCTTTGCGCGTTCGTTCTTGCAACTGAACCCGTTGGCCAGTCCTGGCGTGGCGTAGCCGG
AATGTCCACTTTCTATTTTTTCTCTATTGGAATAGCCGCCTTATCCGCCATTGCATATTT
CTTCCAAACGTGGCGATCACTCTACATTGCTTCATCAATCCCATCAATTATATTTGTTAT
CTTACTACTTCCTTTCATTCACGAGTCACCTCGTTGGTGTCTCGTGAGGGGGAAAGTTGA
CGAAGCCATGAAGATCATGCGTAAAATTGCTAAATCCAACGGTAAACATCTCCCTGATGA
CGTTGTTCTCGCCCTCGATAGTGAAGTGAACGATGATGTTCCTGATTCTCAATCCGTATC
AAAAGAAGCCCTAAACGGATCCTTATTAGATGTACTGAGGCTTCCTTTGACGCGATTCCG
GTTATTCTTAGCTGTGGTGATCAACTTCCTTTGCTCGGTTGTTTATTACGGGTTGAGTCT
GAACGCTGTCAACCTCGGGACCAACCTCTACCTCAACGTCGCCCTTAACGCGGTTGCTGA
AATGCCTGCCTATTTGTTAACCGCATTGGTGTTGGACAAGCTTGGTAGAAAGCCGTTAGC
GATAGGGACAATGTGGTTCAGCGGTATATTCTGTCTAGCTGGAAGTTTGGCGAAGGGTGA
TGGTACTTGGAAACTGGTTCGGATGGTTTGTGGAGTGTTAGGGATATTCGGCATGGCGGG
GACTTACAATTTACTATTTGTGTATTCGATGGAGTTGTTTCCGACTGTGGTGAGGAATGC
TGCGTTGGGATGTGCAACGCAGGCGTCACAGATGGGGGCCATTTTGGCCCCCTTTGTAGT
TGTTTTAGGGGGTGGGATACCATTTGCTGTGTTTGCGTTTTGTGGAATTGCTGGAGGCTT
ATTGGTAATTTACTTGCCAGAGACTTTAAACAGGCCATTATATGATACAATGGCTGGCAT
GGAAGAAGCTGAAGCAAAGAAGCCAAGCAATTTATCTTAATTTGCTAGTTTTTGAGAGCT
TTTTTTTGTGTACTTTTAGTTGTTGAATGTAATTTTGGGTTGGATTGTACTAAGAGTTCA
TCTTATATTAGGTAGTCATAACTCATAAGGCATATGCCTAGTCATAACAAGGCAAGCTTG
AAATTGTGCTCTATGGCGAGTGGTGGGTGAAAGGATGGAGGGTGGTCAGATGAACATCCT
TACGAAAAAAATTCTATAATATATTATAAAAAGTAGCATTCACCATGTTATATATCATGT
TACTTTCTTT