Microarray Probes on PGSC0003DMT400049493

Probe IDChipProbe Sequence
CUST_37588_PI426222305 JHI_St_60k_v1 CAGCAGATGAAATAGCTTTTCTTGCATGTCATGTAGTTTCACTGTTCCATAGATAATTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049493

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049493 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G48150.1 +2 2e-169 498 242/372 (65%) GRAS family transcription factor | chr5:19522497-19524053 REVERSE LENGTH=490

Transcript Sequence (2068 bp)

>PGSC0003DMT400049493 2068 pgsc_dm_v3.4
CGTGTATCGTTTGCAGGTTGATATTTTGACAGATACAAGCTGTTAAGTGCGCATACTAGG
AGCGATTTGTGCTTAGAGCAGCTAATGATAGCCATATAGTATGGAATCACACCATCTGTA
TGGATATGGTGGGACTGATGTGAATTTGCCATATTCTTACGCTATGACTACTACTCCTTC
GATACCTAATAGGCTGTTGGGAACATTGAAATTTGATTCGGGAAATTCTCCAAATTCTCC
ATTTGCAAACTATAATGATCCTGGTACCCCTACCACATTAAGTGATAGCCTGGAGCAACA
CAGCTCTACTGAAAATATTTCAGGGACTAGTCCTTGCAGTAATTCCTCGCGGGATTATAA
TCTTTATTTCTGCAGGCCTAGCCCCTCAGCAGATATCCGCCATAACAGTCTTCTGGTTTA
TTCTGGTGATAATTCTTTACTCCAGTATGCAAATCACGGTCACAACATGAAACGTGCACT
GCTTCAATTGGAGACCGCTTTAATGGGGCCAGAAGAAGTCACAACATACAGCCCTTCTGC
AGGGGAAATTCAGCAGCCACAAGCATCAGGTCAGAGGTCCGGGATGTGGCACCAAGATGG
CCAGGTTTCGTATCGAATTGAAACACAGCCATCACATGTTTCTGTCTTTGGCATATCAGG
CAATATAATTCAAAGTGAGAAGCATCACAAACCAATGGTGGATTATCCGTCACAGGGGAT
TCCTTTTGGCAACCTAAAGCAGCTGCTTATCGCGTGTGCCAGAGCTCTTGCTGAGAACAA
CTTGGATGATTTTGAAAAATTGATTGCCAAGGCAAGAAGTGCTGTGTCCATTACTGGTGA
TCCAATCCAGCGTCTCGGTGCTTACATCGTAGAAGGGCTAGTAGCAAGAAAAGAAGCATC
CGGAACCAACATTTACAGGGCTCTCAGGTGTAAGGAACCAGCTGGCAGGGACTTGCTTTC
CTACATGCATATCTTATATGAGATATGCCCTTATCTAAAGTTCGGTTACATGGCTGCGAA
TGGTGCAATAGCAGATGCGTGTAGAAATGAAAATCGCATTCACATTATAGACTTCCAGAT
TGCACAAGGGACTCAATGGATGACTCTTCTTCAAGCTCTTGCTGCCAGGCCTAGCGGTGC
ACCTTATGTACGTATTACAGGTATTGATGATCCAGTTTCAAAATATGCCCGGGGAGATGG
ATTGACGTTAGTGGGAAAAAAGCTGGCAGCCATTTCTGAGAAATTCAACATTCCGGTTGA
GTTTCATGCAGTGCCAGTTTTTGCTCCTGATGTCACCAGGGATATGCTTGATGTGAGGCC
TGGTGAGGCTCTGGCAGTAAACTTCCCTTTGTCACTTCACCACACACCCGATGAGAGCGT
TGATGTTACTAATCCAAGGGATGAGCTTCTAAGGATGGTGAAATCGTTTTCTCCCAAGGT
AGTCACTTTGGTGGAACAAGAATCAAACACAAACACTGCCCCCTTTTTCCCTCGATTTCA
AGAAGCTCTAGACTACTATTCTGCAATGTTCGAGTCCATAGATGTAACGTTAGAAAGGGA
CAAGAAGGAGAGGATCAACGTGGAGCAGCATTGTTTGGCAAGGGATATAGTTAACGTCAT
AGCATGCGAAGGCAAGGAAAGAGCGGAACGCCACGAGCTATTAGGGAAATGGAAATTGAG
GTTCGCAATGGCAGGGTTTCACCAGTATCCTCTGAGCTCTTACGTAAATTCGGTGATAAA
GAGCCTCATGAGGTGCTACTCAGAGAATTATACACTGGTGGAAGAAGATGGAGCTATGTT
GTTGGGATGGAAAAAGAGGTACCTAATCTCTGCATCAGCTTGGCACTGAAAGAAAAAAAG
AAAATTACGAATGGTGGACTAAGCTCCCACTATGTGCGGGATCTAGTGAAGATCTAGTTT
AGCAAATAACAAGTTTATAAGTTCATTAAGTAGAGAAAGCAGCAGATGAAATAGCTTTTC
TTGCATGTCATGTAGTTTCACTGTTCCATAGATAATTTCATGTATCAAAAACTATATTAT
TGTTTATAGACATCTCTTATTATGTTCA