Microarray Probes on PGSC0003DMT400049277

Probe IDChipProbe Sequence
CUST_20019_PI426222305 JHI_St_60k_v1 GCCCACAGCTTTACTTGCATATTGTTATTATTATGGTGATGTAATGGCAAATTATTGCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049277

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049277 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G37640.1 +1 2e-148 426 200/255 (78%) Barwin-like endoglucanases superfamily protein | chr2:15788077-15789812 REVERSE LENGTH=262

Transcript Sequence (1231 bp)

>PGSC0003DMT400049277 1231 pgsc_dm_v3.4
TCTCAATTCGCTCTCTGCTCAAATCCCATTTTCCCTTTCTCTCTCTGTTTTCTCTTCACA
CTGAACAAACACTTCACTGTGAGAAAAATGGCTGTGAATTGGGCACTCTGCATTGCTAGT
CTTCTCTGTTTTCTAACGGTTGTTAACGCAAAAATCGTCGGAGTTTACACCGGCGGATCC
TGGACAAGTGCCCACGCCACCTTTTATGGAGGCGCTGATGCTTCTGGAACCATGGGTGGT
GCATGTGGCTATGGGAATCTGTACAGCCAAGGGTACGGAGTAAACAACGCGGCATTGAGT
ACGGCACTTTTCAACAGTGGGCTGAGCTGCGGCTCTTGCTTCGAGATAAAGTGTACTGAC
AGTAAGAAGGAATATTGCAACCCTGGAAACCCTTCCATCTTGGTAACAGGAACAAATTTC
TGCCCACCAAATTACGCCTTGCCTAACGATAATGGAGGTTGGTGTAACCCACCTCGCCCA
CATTTCGACCTCGCCATGCCCATGTTCCTCAAAATTGCTGTGTACCGTGCTGGAATTGTT
GCTGTTAACTACCGAAGGGTTCCATGCAGGAAACAAGGAGGAATCAGATTCACAGTCAAC
GGTTTCCAATACTTTAACTTGGTGTTAGTAACCAACGTTGCAGGTGCAGGGGACATTCAA
AAGGTTTATGTTAAAGGCACAAACACGCCATGGATTTCGATGACTCGTAATTGGGGTCAA
AATTGGCAAACAAATGCAAAACTAATCGGACAAGCACTTTCTTTTAGAGTCACTGGTAGT
GATCGACGCAGCTCTGCTTCATACAACATTGCACCAGCTAACTGGCAATTTGGACAAACT
TTCCAGGGAAAGAATTTCCGCGTTTAATTTCACCAAATTTTAAATAATTACACTGACCTG
ATCGAAAAAAAGAAAAATTCATACGATTTCCCACCTTCAATTATTCTCTTTTTTATCTGG
GAAAATTTTGAAGTGTCGCGGGGGATTAGTTTCTTTTTCTTTTGAATTACTATCAACTTT
CTGGGGAATTGGTTTGTTACTCTTTTTTCTTTTTATGTAAGTTGGGTGTTGGTAAAGTTA
AAGTGAAAAATTATAGAGGCTGAAGTGGCTACAAAAGGACCAAATTTAGGGGGGAAATTG
TAGCCCACAGCTTTACTTGCATATTGTTATTATTATGGTGATGTAATGGCAAATTATTGC
CTAAGTTTATGAATATATTTTTATACTGCAA