Microarray Probes on PGSC0003DMT400049196

Probe IDChipProbe Sequence
CUST_19967_PI426222305 JHI_St_60k_v1 TTGTGGCTTGTGGTGAAGGACTAAGGTCTTTGATGGCTATTTCAAAGTTACATGAAGGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049196

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049196 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G08920.1 +1 2e-82 252 122/186 (66%) Rhodanese/Cell cycle control phosphatase superfamily protein | chr3:2712274-2713117 FORWARD LENGTH=214

Transcript Sequence (955 bp)

>PGSC0003DMT400049196 955 pgsc_dm_v3.4
AGGGAATAGAATATATAAAAGAAAAAAATCAAACATGATAAGGTAAAGTCCAAACTAAAC
AAATTCTTCCAGATAAGGCGTAGATTCAGGACTGCAAAAGCAAACAAGCAAGAAATAAGA
AAAATGGCATTAATTCAACTACAATCCTCCATTTTAAAGTACAACAAACACCTCCAATTC
CCATCATTTTCCAGTATCCCTCATCAACGCTCAACAATTCTCAAAATCAGTGCAGTTTCC
CCCAATGCACAGCAGCTAATACAGTCCGGTAAAGTCCGCCCAATATTACCCAAAGAAGCA
GGTACAGCGATGGAAGGGGAAGGATATATTTTGCTCGACATTAGGCCAGAATGGGAGAGA
GAGAAGGCGTGTGTTTCGGGTTCATTACATGTGCCCCTCTTTTTGAAGGATATGGATAAT
AGCCCCATTACTCTGTTGAAAAAGTGGGTGCATTTTGGTTATATTGGGCTGTGGACTGGA
CAGAATTTCACTATGATCAATGATGAATTTGTTAAGCAAGTTGAACAGAAAATTCCTGAT
AAGGATAATGCTAAGGTCCTTGTGGCTTGTGGTGAAGGACTAAGGTCTTTGATGGCTATT
TCAAAGTTACATGAAGGAGAATACAGGAATTTGGCATGGTTAGCGGGTGGATTTAACCGC
GCTGCAGATAGAGATTTTCCAGCAGTAGAAGGGACTGAAAAGTTACAATATGCCACTATA
GGAGGCGTGTCATATTACTTCCTTCAATTGCTTATACTACTACAAGCTGTGGGGAAGGAA
AGTTGATAGAATTGTCCATGATGGTGTTGTTATCTTTAGCTCATATTGTAAATTGATTCA
CCAGTTGAAGGTTTAGGCTAAAGTGAATTGAAGTGTTTCTTCCTTTTGTTTAATAACACA
AGATTGTTTGGTGCTCCCAATCCATTTATACATTTCCTGAAGTAACTACGTACTC