Microarray Probes on PGSC0003DMT400049193

Probe IDChipProbe Sequence
CUST_20005_PI426222305 JHI_St_60k_v1 AGAACAAAGGGTCCTTGTGGAAAATCTCAAGTTGAATCACTAAAATCGCCAAGATAAATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049193

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049193 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G55970.1 +1 8e-84 256 124/186 (67%) jasmonate-regulated gene 21 | chr3:20766970-20769264 REVERSE LENGTH=363

Transcript Sequence (649 bp)

>PGSC0003DMT400049193 649 pgsc_dm_v3.4
GAAGTAATGAGATTATGTAAAAGATTAACTAAAATCTTATCGATAAACCTTGGATTAAAT
GAAGATTATCTACACACAAAATTTGGTGGAGACAATGAAAGAGGTGCATGTTTAAGGGTT
AATTTTTACCCAAAATGTCCCCAGCCTGACCTAACACTTGGACTCTCTCCCCACTCTGAT
CCTGGTGGCATGACCCTTCTCCTCCCTGACACCGACGTCACCGGCCTCCAAGTCCGTCGT
GGTGATGACTGGATAACAGTTAAACCGGTTCCTAATGCCTTCATCGTCAACATGGGAGAT
CAAATTCAGGTATTAAGCAACGCAATATACAAGAGCATAGAGCATCGTGTAATCGTTAAT
TCTGCGAAAGAACGTGCTTCTTTAGCGTTCTTCTACAATCCAGGAGGTGATATTCTCATT
AAACCTGCAGATGAACTTGTGACGGAGGATTGGCCGGCGTTATATTTACCGATGACGTTC
AACGAATATCGAGCTTTCATTAGAACAAAGGGTCCTTGTGGAAAATCTCAAGTTGAATCA
CTAAAATCGCCAAGATAAATAATTACACTATCTTTTTTTATTTTAAAGTATTGCATAATT
TTAATTTGATTTTTCCATCATGTCATGTCTATTGTATTTTTGCTAAATT