Microarray Probes on PGSC0003DMT400049142

Probe IDChipProbe Sequence
CUST_52392_PI426222305 JHI_St_60k_v1 AAGAAAAAGTATGCACCTATTTGTGTCACAATGCCAACTGCTAGAATATGTCACAAGTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049142

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400049142 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G51400.1 +1 4e-15 67 47/116 (41%) Photosystem II 5 kD protein | chr1:19052172-19052492 REVERSE LENGTH=106

Transcript Sequence (348 bp)

>PGSC0003DMT400049142 348 pgsc_dm_v3.4
ATGGCTTCTTTACTAATGTCATCTTCATTTCTAGTCCATATCGGAGAATTCAACTACCAA
AGAACCAGGAACGAAGGGTTTTCCCCCCTCTCCGCGCATTCAAATAGGAGAAGAGTGCTA
AAAGTTAATGCCTTTAATAAGGATGAAAAAATTGTGACAAAAAAAGAGGAAAAAAAGAGC
AATGGATCAAGAAGGGAATGGGCTTTTGCCATAATGGCAATAGTAGCAACAAGTTCATTT
GCAAGTGTTGTTATAGCTGAGGAACCAAAGGCAAGGACACTTAAGGCAAAGAAAAAGTAT
GCACCTATTTGTGTCACAATGCCAACTGCTAGAATATGTCACAAGTGA