Microarray Probes on PGSC0003DMT400048535

Probe IDChipProbe Sequence
CUST_35288_PI426222305 JHI_St_60k_v1 CAATGTACTCAATAGTAGTGGCACCTATTAGTTTCCCATTCATAAAAAGTGGCTAAATTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400048535

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400048535 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G61520.1 +1 0.0 563 291/484 (60%) Major facilitator superfamily protein | chr5:24739358-24741175 REVERSE LENGTH=514

Transcript Sequence (1837 bp)

>PGSC0003DMT400048535 1837 pgsc_dm_v3.4
TACATAAGTCAGACCTTACAATTCATACTTGCAAATTTCACTCTACACAGTTTAATTTGA
GCTTGTAGAGAAGAAATGGCAGTTGGTATTGTCCCAACAAGTGAGGGTTCCGCGGATTAC
AATGGAAGGATTACGTGGTTTGTGGTGTTATCATCCATCGTTGCTGCAACCGGAGGAATC
ATCTTTGGTTATGATATCGGAATTTCAGGAGGAGTGATCTCTATGGCGCCGTTTCTGAAG
AAATTCTTCCCAGAAGTGTTCACTAAGATGACACATGTAGCTGAAATAAGCAACTACTGT
GTATTTGACAGCCAACTACTGACCTCTTTCACTTCCTCTTTATACATTGCTGGTCTTATT
GCTTCCTTCTTGGCCTCACCAGTCACTCGTACATATGGCCGTAAACCAACAATTATAATC
GGTGGAATAGCATTTCTCATCGGTTCTGCCCTTGGAGGCGCAGCATCCAATATCTACATG
TTATTACTTGGTCGAATCCTGCTAGGTGTAGGTGTTGGTTTTGCAAATCAGGCAGTCCCT
TTATACCTTTCAGAAATGGCACCTGCTAAGTACAGGGGATCTTTCAATATCGCGTTCCAA
TTATGTGTAGGAATTGGAGTACTATTTGCTAGCCTTCTTAACTACGGTGTTCTAAAGATT
AAAGGTGGTTGGGGATGGAGAATTTCCTTAGCGATGGCTGCAGCTCCTGCTACATTTCTA
ACAATAGGAGCATTTTTTCTCCCAGAAACCGCAAACAGCCTAATTCAACATGGAAATGAT
CATCAAAAAGCTAAGAAGATTCTACAACGTGTACGTGGTACAACCGATGTGCAAGCAGAA
CTAGACGATCTCATCAAAGCAAGTGACAAGTCAAAAGCCGTCAAGCATCCTTTTAAGCAA
ATCATTAAACGGAAATACAGGCCACAACTTGTTATGTCAATATTAATACCATTCTTCCAA
CAGGTGACTGGGATCAACGTGATCTCCTTCTACGCTCCAATTCTGTTTCAAACAATAGGC
CTAGGTGCGAGTGCATCACTTATGTCTGCTGTGGTGACAGGTGTGGTAGGCACCAGCGCG
ACTTTCTTAGCATTGTTGATAGTTGACAGGGTCGGGCGAAGGGCTATGTTCAGTTTTGGG
GGAATCCAAATGTTTGTATCACAAATGTTGATAGGGATAATAATGGCAGTTAAGTTAGGA
GATCATGGGGTGTTGAGCAAGGGGTATGGGCTATTGGTTTTGGTGTTGATATGCATTTAT
GTTGCAGGTTTTAGTTTGTCATGGGGTCCATTAGGATGGTTAGTTCCAAGTGAAATATTT
CCATTAGAAATAAGGTCAGCAGGACAAAGCATAACAGTGGCTGTGGGGTTAATATTCACT
TTTATAATTGCTCAGACTTTCTTGGCTATGCTCTGCCATCTAAAATCAGGGATTTTCTTC
TTCTTTGGGGCATGGGTTGCAATCATGACTGTATTTGTCTACTTTTTCTTGCCAGAGACA
AGGAATTTGCCAATTGAAAATATGGAAAGCATATGGAGGGATCATTGGTTTTGGAAGAGA
TTTGTTTTTTATCAGCAAGACTATGACAAGGGTGACACTACTTAAAAAGCTATTGCCACT
CATTTGCTTCTCAAGCAATTCCAATATACTACTATAAGTTAAACATATTTCCTGTTGGAT
ATGAATTGTAATTTGAAAAAGATTTACAGTTCAATACCCTCCATCTAGGGGAATTATAGT
TGATTTTTTATGGTCTTTTTGTCAATGTACTCAATAGTAGTGGCACCTATTAGTTTCCCA
TTCATAAAAAGTGGCTAAATTGATATTTATGCAAAAC