Microarray Probes on PGSC0003DMT400048392

Probe IDChipProbe Sequence
CUST_40324_PI426222305 JHI_St_60k_v1 TCCAAACAATTCCGACTCAGTATTGCATATTTTTTGAAAGAACAAGAGAGCCATCTCCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400048392

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400048392 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G34060.1 +2 2e-46 172 82/163 (50%) Pyridoxal phosphate (PLP)-dependent transferases superfamily protein | chr1:12396561-12398299 REVERSE LENGTH=463

Transcript Sequence (2060 bp)

>PGSC0003DMT400048392 2060 pgsc_dm_v3.4
AAAAGATTGAAATTGCAAATTTATTCATGTTCAACTGTACTATCCCTTAGGCATGTATTA
ACTTTATGAGTTATTAATACTGTTTGTGTTTGATATCCTTTTTATAATTAATGCAATGCA
TGTTATTTTTAATATACCAAATCAAACACTACTGCATCAGAAATAATCTCAGCATAACTA
CTATCAGCATTACAATTTACACCCCTACCATCCAACCCCTTAAAAAGTTGATTCTTTCAT
CATTTTATTGTGTAATTGATTGTATAATTAATATGCAGTGGTGATCCTCTATTCTTGGAA
CCATTCTGGATGCAAAATGCAGCTAGCAGTGCAGTAGTAGTGGCAGGATGGCATAGAATG
AGCTATGTATTTCCTAATAATCTGTCCTTTATATCCAAAGAACTTGAGAAAAGCATAAGA
AAAATACATGCAATTGCCAAGAATGCTATTACACATGGAAAATACATTATATTTGGAACA
GGCTCTACTCAGCTTCTACATGCTGCAGTTCATGCTCTATCTATGGATAATAAAAATTCA
ACAAAAGTGGTTGCAAATAAAATCCCTTATTATTCGGTAATTCGTTCTCTATTACATATT
AATAGTCTGTTTGGCCAAGCTTTTTGGGTAGTCAAAAAAGTAAGATATTTGATCAAGTTT
TTGGGAGAAAATAAGTGCTTTTGGGGACTAGCAAAAACTGTTTTTCAAAACTAAAAAATA
TTTTTTTGAGAAGTAGTTTGGAAAAGCTTGGTATTGTTGCTCAAAAGTGTTTTCGAAATT
TATTGAATCAAACACAAACTGTTTCTCACTAAAAGTACTTTTTATCAGCTTTATAAGCTT
CAAACGGAATACTTTCAAACACGTAATTGTGAATTTGGAGGAGACTCATCCATGTTGAAG
AACAACTCAGATTTTGCTGGAAATGTGATTGAGTTTGTGACTTCACCAAATAATCCAGAT
GGAAATTTGGAAAGTCCAGTTCTAAATGGTCCAAATGTGAAGCACATTTATGATCATGCT
TATTATTGGTCTCATTATACAGCAATTCCAGCTCCTGCTGATGAAGATCTCATGATTTTC
TCTATGTCTAAGCTCACTGGTCATGCTGGATCCAGATTTGGGTAATAAAAACAACTCTCC
AAGTGAAAAATAGTCGTTTTGGAGTTTCAAATTCCACAAGTGAAACTCCACAACACATTA
TCCTGGATTTCTCTTGTGAAATTTAAAACTCGAGAACAATGACTATTTTTAGTTACAGAA
ACAACTAATTGTTATTCATTAATGTATGTGGGCAATTGTGAAAGATGTGAATGTGTATAC
AAGAATGATGGAATTTATTAGTTTGGCTGAAATGGGTACCTCAAAGGATGTTCAGTTGAG
AGCTTTAACACTATTGAAAGTTGTTGCTCAAGGAGATGACAAACAACTCTTCAATTTTGC
ACAACAAATCTTGACGGATCGATGGAAAAAATTGAGTCATATCTTCTCCCTTACTAAACG
TTTTAGCCTCCAAACAATTCCGACTCAGTATTGCATATTTTTTGAAAGAACAAGAGAGCC
ATCTCCAGGTTATGCATGGGTGAAGTGTAAGAGGAAAGAAGATAAAAACTGTCAAGAAAT
CTTCAGAGTTGCAAAAATCACAGGTCGTACAGGTAGACAGTTCTTTGCAGGAGATCGTTA
TGTTCGATTCAGCTTGCTGAGAGGCCAACATGATTTTGACATGTTGATCCATCGACTGAA
AGAATTGATCTACCAAGAATATGAAGCCAATGCACAAGCCATGTCAAGTTTTTAACTATT
AGATGATTATGCATATCTTCCCTGTGATTTCATCATGTAATATTATTTACCTTAAAATAT
CATGTAAACCTTCCTAGATTTTAAGTAGGAGTGCGTCTATACTAGTTAGTAGAAGTGTAT
TGTCTTGGTTCCCTTATCAGCAAGCGTAATACTACTCTTGTAGTTTCTTGTTCTTCAACT
TATGTTACTATATGTTGTTTCGTATGGTTCGATTATAAGATTATTATTGTAGTATTGTTT
TGCTACTATCTGTTGTTTTT