Microarray Probes on PGSC0003DMT400048375

Probe IDChipProbe Sequence
CUST_40327_PI426222305 JHI_St_60k_v1 AGAAGCTAATCAAGGCCCATTCTTTGGTTTTATTGCCAAGAATGAAATCTCTAATGGAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400048375

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400048375 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G34000.1 +2 8e-35 89 63/122 (52%) one-helix protein 2 | chr1:12358151-12358902 REVERSE LENGTH=172

Transcript Sequence (1060 bp)

>PGSC0003DMT400048375 1060 pgsc_dm_v3.4
TTCCATACAAAATTTCTTTCTGATAGCATAACAACTAAGAAAAAAACCAAACACTATCTT
CTTCTTCTGACAAGAAAAAAAAATCAAGAAAATGTCAGTGGCATCATCATCTACATTCCC
TTGCATTAAATTCCAAAATTACCCTTCTTATTCAACAAAGCCTATAATACTTACTATAAG
AAATTCTCAAGCTGAAGGTCCAATTAGAAGACCAGTTGCTCCATCACCACCTAAGCCTAG
TAATATCCCACCACCAATTATTACTACTACTGCCCCTCCTAAGCCTGTGGCTGTCACAAC
TTCTGAGGGTAAAAATGTAATTACACTTGAATTTCAGAGGCAAAAGGCTAAGGAACTTCA
AGGATACTTTAAACAGAAGAAACTTGAAGAAGCTAATCAAGGCCCATTCTTTGGTTTTAT
TGCCAAGAATGAAATCTCTAATGGAAGAATGTGCAGAAATTAGTGCAAGTTTGGTTACAG
TACACTTTGTACATACACATTCTTTGCACTTGATGTTATGGAAAAACATGTATATGCAGA
TGGGCGATGTTTGGTTTTGCTGTTGGGATGTTGACAGAGTATGCAACGGGTTCTGATTTT
GTCGATCAAGTTAAGATCCTTCTCTCCAATTTTGGCATTGTAGACCTTGAATGAGACTTT
TGCTGTAAAAGAGCTTATAGATTCATTTGTTTGAGCCACAATTGTTGTATCTTACAACTC
CTTTTTACTTTTCAACAAATATATATAGCAAGTCTGATAAAGATTCTCATACTTGGACTA
CAACTTTTTTATTTAGTTTCCCACTCGGTGTTCTGAGCCCATATTAGAGTTCCGACTAAA
TTCGGATCGCGCACTGCAGGGTCCATTCAGGGGTAGTGCTCCCAACATAATTTTCTCCAT
ATCCAGTGCTCAAACTCGAGACCTGGGTGAAGCACTTCCACCAGTTCACCAAGATATGTG
ACTGGACAGGCTTCTACCTCCATCTCTTATTCCAAGTTCTTTTTACTTTAAGCATTTATC
ATTTTCGATATAATGATTTTTATTTTTTTTTGATATAAAG