Microarray Probes on PGSC0003DMT400048297

Probe IDChipProbe Sequence
CUST_16998_PI426222305 JHI_St_60k_v1 GGAGTTACAGGCACCGGAGAGTGAAACTATTTATTACTATAACTACTACTTTGTTTGTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400048297

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400048297 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G21820.1 +3 4e-21 84 56/79 (71%) unknown protein; Has 45 Blast hits to 45 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:9302983-9303219 REVERSE LENGTH=78

Transcript Sequence (494 bp)

>PGSC0003DMT400048297 494 pgsc_dm_v3.4
GAAAAACCAAATTTACAATACTGTTAGCTAAATATACCAAAAATACAAGATTTAGAAAAT
TTAGAAAGATGTCAGGGGCACAAGGTGCACAACCTAAGGAATCTTTAACAGCAACAACGT
ATGAATCAATAGTGAAAGAGGAGAATAGGCCACGAATGGATATTCATTCTCGTGAAGATG
AAAAAGGGATTCAAATTGATAAAATTCAAGATAAGGTAGATGATGCTGCTGGCAAAGGTG
GTCCCGTTTTCGGGGCTGGTAAAGACGACCACAACAAGAAGGATTTGGGAGTTACAGGCA
CCGGAGAGTGAAACTATTTATTACTATAACTACTACTTTGTTTGTAAATGGTTTTTTTCT
TTAGGGTTCTTTGTTTCTAGTTTTCAAGAATGTTATGTATACCAAGACTCTTATTTAGTT
TGTAACTTTGTAATGTCTCTTTCACGGTTTTTAATGTTTTTATTCAATAATTAAGAGCCT
TAAGTTGATAGTTG