Microarray Probes on PGSC0003DMT400048031

Probe IDChipProbe Sequence
CUST_8922_PI426222305 JHI_St_60k_v1 TTGCGTACTCAATGTTATGCTGTTAGGAAAGTGAAGCTGTACAATCCTGAGGTTTCCTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400048031

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400048031 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G30330.2 +1 3e-120 367 186/203 (92%) auxin response factor 6 | chr1:10686125-10690036 REVERSE LENGTH=935

Transcript Sequence (714 bp)

>PGSC0003DMT400048031 714 pgsc_dm_v3.4
ATGAAGCTTTCAACATCAGGAATGGGTCAACAAGCTCATGAAGGACAGCCTAAGCGGCAT
CTTCTGACGACTGGCTGGAGTGTGTTTGTTAGTGCCAAAAGACTTGTCGCTGGAGATTCA
GTTCTTTTCATCTGGAATGAGAAAAATCAGCTTTTTTTGGGAATTCGTCGTGCAACTCGA
CCTCAGACTGTGATGCCATCATCTGTTCTGTCTAGTGACAGCATGCACATTGGATTACTT
GCTGCTGCTGCTCATGCTGCCGCTACCAATAGCTGTTTCACTGTTTTCTTTAACCCAAGG
GCTAGCCCATCTGAGTTTGTTATTCCACTTTCAAAATACATCAAAGCTGTTTATCACACA
CGTGTTTCTGTTGGAATGCGTTTCCGGATGCTATTTGAGACTGAAGAATCAAGTGTTCGA
AGGTACATGGGCACAATTACTGGCATTGGTGACTTAGATCCAGTTCGCTGGGCCAACTCT
CACTGGCGGTCTGTCAAGGTTGGTTGGGATGAGTCAACGGCAGGCGAGAGGCAACCTAGG
GTTTCCCTATGGGAGATAGAGCCTTTGACTACTTTTCCAATGTATCCATCTTTGTTCCCT
CTTAGGCTAAAGCGGCCTTGGTATCCAGGAACTTCATCTTTTCAAGGTATTTTGCGTACT
CAATGTTATGCTGTTAGGAAAGTGAAGCTGTACAATCCTGAGGTTTCCTTGTAA