Microarray Probes on PGSC0003DMT400048019

Probe IDChipProbe Sequence
CUST_45941_PI426222305 JHI_St_60k_v1 GGATCAATTACTTGCTCATATGGTAATTGGTATAGGACACGTGTTATTCAACTGCAAGGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400048019

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400048019 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G19250.1 +2 1e-71 166 92/241 (38%) flavin-dependent monooxygenase 1 | chr1:6650656-6653053 REVERSE LENGTH=530

Transcript Sequence (2153 bp)

>PGSC0003DMT400048019 2153 pgsc_dm_v3.4
TTTACTTGATTGTGATAGGACTTGCATGTCCCCTCGCAACTCTCTATATACACTCCGATC
CATCATCCTCACATCTAAATAAAAAAAAACAAAAAACGCAGTACGTTGCAATGGCAGATT
TTAATGAGAGAGAGAGCAGAAAGAAGGAGGTGGTAGCAATAATTGGAGCTGGAATCAGTG
GCCTCTTGGCTTGCAAATACTGTCTTTCCAAAGGATTTGATCCAATTGTGTTCGAGTCGG
AGAGTAGCATCGGAGGTGTTTGGACTAAGACCATTGGGAGCACTAAGCTGCAGACACCAA
AACCGTTTTACCAGTTCTCTGATTTCCCCTGGCCCAATTCTGTAACCGAAATGTTCCCTG
ACCATCAAACGGTGCTGGAGTACATTGAATCATATGCACGTCACTTTGATTTGGTCCGCT
GCATTCAGTTCAATAGCAAAGTGTTGAGCCTCAGCTATGAAGATGGCAAACTTAGTGGAG
ATAATTGGAATGTCGTTTGGGGCGAGGTATTTAACACTAACAGTAAAGGGAAGTGGAACA
TCAATGTGCAGGACACTCCAACCTTATCTACACAGGAACGTTCCTGACTTTTTTTTACTC
TCCGATCCGAGTTAGGGTAAAAATGAATTAAAGTTATTTACTAATATTCCCCTGTAACAT
AGATCAGTGCCATTTCAAAGAGTACTTTTTATCAATATTGGTCAAGTATGAATAGAATAT
TTGTCATGGTTGGTTGAAAACTGAAATTGAAATTAGTGCGTGCAGGTATACCAAGTTGAT
TTCGTAATAGTTTGTGTGGGAAGGTTCAGCCAGGTTCCAAACATACCTGAATTTCCTCCG
AAGAAAGGGGCGGAAGCTTTTGAAGGCCAAGTTATCCATTCAATGGAATATTCCAATATG
GACCCCGAAACAGCAGCCAATTTTGTTAAAGGAAAACATGTAGCCATAGTTGGATTTCAG
AAATCAGGAATGGACATCGCCATGGAGTGCTCTACCATTAATGGGACTGAACGTCCATGC
ACGGTAGTAATCAGGACACCGCATTGGAACCTTCCCGATTTTTTCCCATGGGGACTCAAT
TTGGGATATCTCTACCTAACTCGATTCTCTGAACTAACGGTGCATAAACCTGGTGAAGGG
CTTGCTCTAAGTCTCCTCGCCACAACACTTTCACCATTGGTAATGAAGTTAACTGCTACT
ACTATGCTATCCTTTATCACCATCCCAAACTAATAATGATAATTTTTCACTACAGAGGTG
GGCCTTGTCAAAATTTGTAGAAATTTATATAAGACGCAAACACAGGCTTGCAAAACATGG
AATGGTGCCGGATCATAGCTTCTTAAACGAATTCAGTTCATGTTCACTCTCTATAGTGCC
AGAGGGCTTCTACGACAGAGTTGAGGAAGGAAGTATCAAGCTGGTCAAGAGAGCAGAGAG
TGTTGGATTCTCTAAAGAAGGTATGATGCTCAAGGGTCAGGCGGAACCACTTAAATCGGA
CTTAGTCATACTATCTACTGGGTTTAAGGGAATTGATAAGCTCAAACACATTTTTGAATC
AAAAAAGTATCAGGACTTCATTGCAGGCTTAGATGATTCTGCTGCAGTTCCCCTATACAG
GGAATGCATCCATCCCAGAATTCCACAATTGGCAATAATTGGATTCTCAGAAAGCATAAC
CAATCTATACACATCGGAAATAAGGTGTCGATGGCTGGCAGAGCTTCTTGATGGAAAATT
CAAGGTACCTAGCATCAAAGTTATGGAAAAAGACATAGCGGAGTGGGATAAGTACAAGAG
GAGATATTCATATAACAAGTACTATAGGAACTCGTGCATCGCTGCATTGCACGTTTGGCA
CAATGACCAACTTTGCAAGGACATGGGATGGAACCCAAAGAGAAAAAAGGGGTTTTGGGA
TGAGTGGTTCCAACCTTATGGACCAATGGATTACAGGGGCTAATATAAAAGATAGAGCTC
TAAAATCCTATTATTATTTTTTTATGTCAAAGGCAAACCCGTGTGATTTGAAGTTTGTAG
TTTTCCTTTCTACAATAATAATGTAGTATTTGGTTTCAAACCTGGCAAGCTCTGGATCAA
TTACTTGCTCATATGGTAATTGGTATAGGACACGTGTTATTCAACTGCAAGGC