Microarray Probes on PGSC0003DMT400048001

Probe IDChipProbe Sequence
CUST_45890_PI426222305 JHI_St_60k_v1 GACACTGGTGTTAAAATTAGCTTCTTCAATCCTCAGTAACTAGTATGAACATGCGAAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400048001

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400048001 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G47670.1 +3 3e-81 256 110/207 (53%) Transmembrane amino acid transporter family protein | chr1:17536834-17539486 REVERSE LENGTH=519

Transcript Sequence (786 bp)

>PGSC0003DMT400048001 786 pgsc_dm_v3.4
ATTGATTGATGCAGGCGACAATGCCTTCGAGTGAGAAGCACCCATCGCAAGTGCCTATGT
GGAGGGGTGTGCAATTCGCATATCTACTCATAGCAATGTGCCTATTCCCTCTTGCAGTTG
GTGGCTACTGGGCTTATGGTCATTTGATTCCAGCAAACGGGAGTGTGTTAACGGCATTAT
TTGCATTCCATAGCCAAGATGTTTCGCGATCTGTATTAGCTTTAATAAGTATTTTTGTGA
TAATAAATGCGGTGAGCTCATTCCAACTGTACGGAATGCCAATGTTTGACGATATGGAAT
CAGCTTACACAACAAGGTGCAAAAAAGCATGCCCGTGGTGGCTCCGTTCGATATTCAGGG
CAATCTTCGGGTTCGTGTGCTTCTTCATTGCGGTGGCTCTTCCATTTTTGGGTAGCTTTA
CTGGGCTTATTGGAGGAATTGCTCTGCCTATTACATTTGCTCATCCATGTTTTATGTGGC
TTAAAGTGAAGAAGCCCAAAAAGTACTCTCTAAGTTGGTGGGTAAATTGGGGACTTGGGC
TTTTGGGAATGGCCTTAAGTGGGATTTTGATTGCTGCTGGTTTGTATGTGGTTATTGACA
CTGGTGTTAAAATTAGCTTCTTCAATCCTCAGTAACTAGTATGAACATGCGAAATTAATA
GTACTGAAAAGGTTGGTTTGAACAACAATTTAATTTATTGTTATCTTACTTTGAGTTGGT
AGATTTTATTGTACTTCTTTATGGAATTTCAAGGAATAAATTAGTAAAGAATTTCTTGAT
TCCAAA