Microarray Probes on PGSC0003DMT400047889

Probe IDChipProbe Sequence
CUST_34058_PI426222305 JHI_St_60k_v1 CGTCGGAAAGTTCTACTTATAATTAAAGTGCTCCTTATCAAAGACGAGTTCATTTCTAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047889

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047889 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G63130.1 +2 3e-36 135 67/107 (63%) Octicosapeptide/Phox/Bem1p family protein | chr5:25323190-25323857 FORWARD LENGTH=192

Transcript Sequence (1861 bp)

>PGSC0003DMT400047889 1861 pgsc_dm_v3.4
AGGTAACCTTACTTAGGCTTGAACAACCAACTAAGGCCTCTTCAAAACCCCTTAAATTAT
CACTTATAATATCTCCAATACTTGCAAAATAGAAAAGAAAGAAAAAAAAAGCATGGTTAG
TCCATCCAATAATTCCCATAATTTTCCTCTAAAATTCCTTTGTAGCTATGGTGGCAAGAT
TATGCCCCGTCAAACCGATGGAAAACTCCGGTATTATGGTGGCGAAACACGTGTCCTCTC
CGTTGATCGTTCCATTTCATTCGCAGAGCTATTATTGAAGTTAGGGGAGATGTCTGGATC
AACAGTGAGTTTGAGGTGTCAGTTGCCAAATGAAGATCTAGACGCTCTTGTATCAATAAC
ATCTGACGAAGATTTAGTCAATCTCATCGAAGAATATGATCATGTTTCAACAATATCATC
GTTTCTCAAGATCAGGGCTTTCTTATATCCACCAAAATCCACAAAAAAAGTTGTATCTCC
TACACCTTCCATTGCTTCTACCTCATCCACCAATAGTACCACTATTAGCAACCCCGATGC
CACGTCATCACCAAGTTCATTTTGTTCAACCGTTACTAGCCCTCCTGCGTCAACGAGGCA
TCATGATTGTCCAAGACCATATAAAAAAGTGACACGAAATTCTTTAGATGAAACAATTAA
CGGGCGCATACGTCATATTAGAACAAGATCGTCACCGGTGATGTTTCCTATTTGTCCTGA
GAAAGTCACGGCCAAGATTCCTCAATATGCTTATCATCATAGTCATGGGAATAATAGTAG
CCATATTTATATGATTCACCATGGCAACCATTGGCAATAACACTTGATATTTTCTATTGG
ACAAGGGCAATATTGGAACATATATATACTTTTTATATAGAGAAAAAGAAAACCCCATCA
AGAAAAAAAAAAGAAAAAAAAAGAGGATGAGATATATTTTTTTTTTTATGTAAGAAGAGA
GTGTATATGTCAATAACAAATTGGTAGTTTTTGTGTCATATATATGAGTCCAATTTATTT
TTTTACTACCATGGATGGATATTAACTCACCTCTTTATGTGATGCGTGCCACGTTAAATT
TCTTTCTTTTAAAAAATTATTTTTTATATATTTTTTTTAATCTTGTTGGCATTTTCCAAC
AAATCACAAAAAATGAGTCCTATATCATGTTTGCTTCCCCTCTAATTTTCTAATCTTTTA
CGTCTTTATATTTGTCTCTTTAGTATTTCTCTGCCTCAAAGAGATAATGATAAAATTTGC
GTATAAGATTTTACTAAATATGTTATTGTTATTGTGTTTAGTATTTTGTCTGTTCATTTT
CTATGTGTTAGTATATTGTATCATGATATGCAATTATATCACGTCTCTTCCTTTGGTGCT
AAGTTTCTATCTTGATTTTGTGTACTGCAGGTATATGATGATGAAATCAATTGAAACTCT
TTTTTTCATTTAGACAGGAAATTCTAGTAACCTCAAGATGGGAATTAAGTGGCAGAGTCA
TTTGGTCTGAATGCAACCTGAAGAGCCACACATAGGTAATTATTACATGTCTCTGTGTTT
ATTTTTCAAATTAAAGTCGATATGAATATTCGTTATATGCTATAAAATCTTCTTAATTTT
TTTTATTTCTCACTTCATATTCGATACTCTTTTTGTAGATTGAAGTTCACGTCGGAAAGT
TCTACTTATAATTAAAGTGCTCCTTATCAAAGACGAGTTCATTTCTAAGACTTGAAATTG
ATAACTCTAATTAAAAATGAAGAAATACTTATTACTTCAACTACACAATTGGATCACAAA
AAAATTGTTTTAGTATATGCAAAATAACTACTCCAAATGCTCCATTGAACATAAAAGGTA
G