Microarray Probes on PGSC0003DMT400047663

Probe IDChipProbe Sequence
CUST_22252_PI426222305 JHI_St_60k_v1 TGAGTTTTGGCTTGTGCCTCTCTGTTATGTAAGCTAGATAGTATTATATGTTAGCACTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047663

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047663 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G53486.4 +3 8e-06 43 16/35 (46%) unknown protein; LOCATED IN: endomembrane system; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:21721822-21722529 FORWARD LENGTH=104

Transcript Sequence (601 bp)

>PGSC0003DMT400047663 601 pgsc_dm_v3.4
CAGAAATTTTGAATAAGCACACAGCCATGAGACCTACTTCCAAAGCATTTATTCTGTTTA
TTTTATTTCTCATCTTTGTGTCATCAGGTACTGTTGAAGGCAGCTTGGGCAATGGCTTAA
ACAGCATTCACAAATTTCAAAAGGGGATGAGAGAAATACCAAGAAAGTTGATGGTGGTGG
ATGCAACGTTAGATTATGACTATGCAGGACCTAATCCCAGGCATGATCCCACTAGAAAGA
GAGGTGGCAATCACCCTTGAAGAAACTTTGCATACTGGGGTTCAAAAGAATCAGTAGTTT
TGGTTCAAATTCTATATTTTTATGTTAAGAAATCACGTAAAATATGTATAAATAATTAGT
CAAAAACTCAGTAAGCTGCGTTTTCTAGAATCCAGAGCCCATAATTTCAATATCTTTATT
CCTCCTATGAGTGTGTAGAGATTTTGTTTACAATATTGTTGCCTCAGGGCATAATAAGAA
TTGCAAGTCTCTTGATGAGATGTTGCTTGAGTTTTGGCTTGTGCCTCTCTGTTATGTAAG
CTAGATAGTATTATATGTTAGCACTATTATGTTGTTTGAGTTTTGAAATAGTGAAATAAA
G