Microarray Probes on PGSC0003DMT400047621

Probe IDChipProbe Sequence
CUST_22289_PI426222305 JHI_St_60k_v1 ATTCTGACTCTACTGCTACCGCGCAACTTATGGAAACGAATAAACTTTGTTTTGTTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047621

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047621 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G46680.1 +1 2e-35 132 66/103 (64%) homeobox 7 | chr2:19165777-19166773 REVERSE LENGTH=258

Transcript Sequence (1175 bp)

>PGSC0003DMT400047621 1175 pgsc_dm_v3.4
CACCAGTTTTTAAAAATAATTTCTTGTCAATACAAATATTGAAACTTCTCTCTCAACTTG
GAACAAATGGAACCAGAACTTGAAAATTCTGAGATTTCCAACTTCAAAAAACCCTTTAAG
AACAAGTGTGAAAATGTGAAAAGGTTTACTGATGAGCAAGTGAAGTTACTTGAGACCATG
TTTAAACTAGGGACAAAGATAGAGCCAAGAGAGAAGCTGAAATTAGCAAGAGAACTCGGG
TTGCAACCACGCCAAGTAGCTATTTGGTTTCAGAACAAAAGGGCTAGATGGAAATCGAAG
CAATTAGAACACGAATATCGCATACTTCAATCGAATTTTGACAATTTAAATATGCAATTT
GAATCCTTGAAGACAGAAAAGGAGAGATTACTCATTCAGGTATCCTACTTAATTTCTTTA
GTGAAGATTCTGACTCTACTGCTACCGCGCAACTTATGGAAACGAATAAACTTTGTTTTG
TTTTTTTTCAAAACAGTTGGAGACATTAAATGATCAGCTAGAAAACAACAACACTCGAGG
AAGCGGAAGTCAAGATTCAAGAGACAGTGAATTGCAGCATACAAGTCCAGAAAATGGATT
TACAGAGTTAGAATTGAAGGATTGTTCAGGTTCGAGATTTGATCACAAGAGTATAAATGA
AGAGGATGATGACACAAGAGATAAATACTTCACTCCCAAAGAAGAATCAGAGTTGTGGAA
CCTGGAGGAATTAGGAGACAATAATTCCTTAGAACATTGGTGTGTTGGCTTAGGTAGTAT
TTCGAATTCCAAGTTGTGGGACTTTTGAGCCTCACAGATTGTACATAAATTTCATAAAGT
AGGGAAGGAATATTTATTTATCTCGGTTTCTCTACTTTTCCATTGTGTCCAAGAATCAGA
ATGTAGATTGTTTGTGAATCCTTGTTATTGTTCACAAGAAAGCTTAACAAAAATGTTGCA
GCTAGAAAAAAATATGCATGCAATGAAAGAGGAAAAAAGAGGTAGCCCGCTACACAAAGC
ATCTCGTGTTAGCATAGGGGTGAAGAAAAGATCGCACTATAAGGGGTGTAGAATAGGTTG
TATATTCCAACTCAAGTAGAAGTCAAGGAATTTTAATATGTGATATATACATAAAAAATA
ATTTACCTAGCTACGTACATAGTGTAATTTCCGGC