Microarray Probes on PGSC0003DMT400047324

Probe IDChipProbe Sequence
CUST_32767_PI426222305 JHI_St_60k_v1 ATAAACATGTATAGCGCGTCAAAGGGGAAAAAGAGGAAATTGGAAGTCTTTAATTTGGGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047324

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047324 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G56960.1 +1 4e-173 512 255/332 (77%) phosphatidyl inositol monophosphate 5 kinase 4 | chr3:21080957-21083885 FORWARD LENGTH=779

Transcript Sequence (1570 bp)

>PGSC0003DMT400047324 1570 pgsc_dm_v3.4
GTACATTGCAGTTCCATTGCATTGCACATGCACAGTCAATTGACACATCAGAATAGCTTG
GAGAATATTTCAACATTATAACATCAGTTAAACTTAATCTGAAAATATAACTATGTTTTC
AGGACCCTTAGGAAACTGTTTAAAGTGGATCCAGCTGATTACATGATATCTATATGTGGA
AATGATGCACTTCGAGAGCTCTCATCCCCGGGAAAAAGTGGAAGCTTTTTTTACTTGACC
AACGATGACAAGTACATGATCAAGACCTTAAAGAAGGCAGAAGTAAAAGTTCTTTTAGGA
ATGCTTCCAGCTTATTACAATCATGTTCGAGCATTTGAGAACACTCTAGTTACTAAATTT
TTTGGCCTTCATTGTGTGAAATTGACTGGACCTGCCCAGAAGAAGGTTCGCTTTGTCATA
ATGGGGAACTTGTTCTGTACTGAGTATGCCATTCACAGACGTTTTGACTTGAAAGGTTCT
TCCCATGGCCGCGTCACTGAGAAATCTGAATCTCAAATTGACTCCACTACTACTCTCAAG
GACCTGGATCTCAATTTTATATTCAGGCTTCAGAAAGTTTGGTTCCAAGAGTTCTGCAGG
CAAGTGGACCGCGACTGTGACTTCCTTGAACAGGAGAGAATCATGGACTACAGTCTTTTG
GTGGGAGTTCACTTTCGAGAAGTTTCAGGTTCTGGTGAACCAGTCACAACTGAGACGCGT
AATTCTGGAGTTCGGACTCCTACTGCTAATGCAGACCAGAGTGGTGATGTATCAACTCCT
CGAATTTCCAGGGCTGACATGGATCTTCTTTTTGATCCTTCAGGGTGGGCTTCCATTAGA
TTGGGTATCAACATGCCAGCAAAGGCTGAATTAACAGTAAGAAGAAGCGATTTCGAGGCA
CAGCTAGTGGGAGAGCCTACAGGGCAGTATTATGATGTCATCGTATTCTTTAGTATAATC
GATATACTACAGAATTATGACATTAGCAAGAAGCTGGAACATGCATATAAAGCATTTCAA
TATGATCCAACCTCAATCTCCGCAGTTGATCCCAAGCAGTATTCAAAACGTTTTCGGGAC
TTCATATTACAAGTTTTTGCAGAAGACACCTGAGATTTCAGAAAAGCTAGTAGGCCTTCC
ACGGTATTCGCTGAGGTAACCATGCTAACCACACAACAGTGATGAGAACTATATGGTCAT
GAAAGCTCGGACACTTGCTCCTGGGACGAGGGGTTCTGGCTATGTGCCCCATCAAGACAA
GCAGCCATGGCAAAAGAAGGGCACTGAACTTTCTTTTTCCTTTATTTTTCTATATAGTTA
CATGCATATAATCCATAACTCAGAAAGGCATAGATTAGTTCTGTGAGTAAATGTCCAGCC
ATGTAATTTTTAAGCCTGCCTGACCCAATTGTACATGAAAATAGAAGGGTGAAGCTGAGG
TAGGGTGGATTTTTCTTGCAAACCAATTTTTTTATCTAGAGTGACGAGTCTCTGGAAATC
TACTTATGGAATAAACATGTATAGCGCGTCAAAGGGGAAAAAGAGGAAATTGGAAGTCTT
TAATTTGGGC