Microarray Probes on PGSC0003DMT400046925

Probe IDChipProbe Sequence
CUST_35710_PI426222305 JHI_St_60k_v1 CTTCTAGTAACTACATAAGCCTGCTGCCTATTATCAATGAAAATTTCTGAATTCCATACC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400046925

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400046925 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G49730.1 +2 0.0 837 442/748 (59%) ferric reduction oxidase 6 | chr5:20201355-20204455 REVERSE LENGTH=738

Transcript Sequence (2676 bp)

>PGSC0003DMT400046925 2676 pgsc_dm_v3.4
GGTTTCTTCTAAAACCTTTTTGTATATATTGGTAACTACTTTAGGTGTGTTTTGATATAA
GCTAATAAAGTTTAAAGATTCTAAAATGGGTGAACTCTCAAGCCAAGAACCTCTTCTTTT
GAAAAAAGATGATGAATTTGATTATCTCAATAAGACGCCACTTTTGGTATCATCAACAAA
GTTGATTCTCAAAGTAGTAATGTGGGTGGCTTTTATTACATGGGCTGCTTTTATTTTCTT
GTTGCCTACAAAATTCACTAATGAACTTTTTGGGACAATTGTTACAGCTACCAAAGGATC
TATTTTTGGGACAGCAGGCAGCACATCCTTGATATTCAGTTTCCCAATTATCTTGATTGC
ATTTCTTGCAATTATTCGTCTCGTTGTCGCGGGTGAAGATCAACCTCAAATCAAGAAGGC
TGGAAAAGGTCCAAATTTTAGATTATGGACATTCCCTGTGCTGGTGGATGGACCATTTGG
GGTTGTTACAGCTGCGGAAATGATTGGCGTTATAATCTTCTCAGTGTACATCGTCTGGGC
TGTAGTTATGTATAGTATACAGAATGTTGACCTCTTATCTTCGTATCATTTACCAGACAT
GAAAGAGAGAAGTGGTAAGTTGCTGGAGCTGACAGGTCTCCGTTTTGGATTCATTGGATT
AATCTGCTTAGCGTTTTTGTTTCTGCCTGTTGCACGTGGTTCAGTTCTTCTTCGAGCTAT
AGATATCCCTTTTGAACATGCCACTAGATATCATGTTTGGCTGGGACATCTTACTATGGC
TATTTTTAGCCTTCATGGTCTATTCTATATTATTGGCTGGGCAATTCAAGGGAGACTTTT
GGAAGAACTAGTCGGCTGGAAAAACATAGGAATAGCCAATCTTCCAGGAGTTATCAGCCT
TTTAGCTGGTTTGTTGATGTGGGTGACTTCACTTCCCGGAGTAAGGAGAAATAACTTTGA
GCTGTTCTTCTATACACACCAATTGTATGTGGTGTTTGTGGTGTTCCTGGCTTTGCATGT
TGGTGATTTCGTCTTCATGATGGCTGGAGCTGGGATCTTCCTGTTCATGCTTGATCGGTT
CCTTAGATTCTTCCAGTCACGAAAGACAGTTGACATACTTTCAGCCACATGCTTTCCTTG
TGGAACCGTTGAACTCGTTATTTCAAAACCTGCAAATTTACATTACAACGCCCTTGGCTG
GATATTCTTACAAATACGTGAGTTGTCCTGGCTGCAGTGGCACCCTTTCAGTGTCTCTTC
TAGTCCCCTTGATGGCAAACATCATCTTGCGATTCTTATAAAGGTTCTTGGAGATTGGAC
TGAAAAACTGAAGGGGAACATCTTGAATCTTTCTGTAGAACAATCTGAGACGGAGCCTCT
TTTGCAGCATAACAGGAAAATGACAGCTTCTGTTGAAGGTCCTTATGGACATGAGTCACC
ATACCACTTAACGTATGAAAATCTCATTTTGGTAGCAGGTGGAATTGGAATTTCCCCCTT
TCTAGCTATCCTGAGTGATATCCTCCACTGTATCAACGATAGTTCGCCTTGCCTGCCAAG
AAATATATTAATAGTATGGGCTATCAAAAATTCAGATGAGCTTCCACTTCTTGAGACAGT
TGACATGGAAGCAATCTGTCCACTTTTCTCTGATAAACTGAATCTTGAGATTCAAACATA
TGTGACGCGGGAATCACAGCCTTCATTGGAGGAGGGTAAAACACCCAAAGCAATGCACCA
CTCCTCAATCTCCCCTGGCTTCAACGGATGTCGAATGTCTGGTTTGGTTGGTACTGGACA
TGTCGTATGGTCTGGATTATATGTCATAGTATCCACCATAGGGTTTGTGATCACTGTAGC
ATTGCTGGACATTTTCTACATAAATCCATTCAATATAACTTACTGGTGGTACAAGGGGCT
TTTGTTGATTGGATGCATGACTGCAAGTATTCTTATATTTGGGGGTCTCGTTATCGCTTT
ATGGCATCTTTGGGAAAGGAAAACTTCATCGAAGGAGGAACCACAGGACGCCACAAAGAA
AGTTGACATCTTGCAGCAGAATGAAGCCTCTTTACACAGGAACTTTGGAGAGGCTCGATA
TGTTAATAATATTCGATATGGTCAAAGACCAGATTTCCAAGAGATATTTGGATCACATGC
AAAGAGTTGGGGAAGTGTAGATATTGGTGTGATTGTGTGTGGTCCTCCTACTCTTCAGTC
CAGTGTTGCTAAAGAGTGCAGAAGCCAGAACTTGAAGAGAAGAGGCCATCAGGCTATTTT
CCATTTCAACAGCCACAGTTTTGACCTCTAGATGACCCCAGTAAACATGGGCGGAGCTAG
ATAGGGTACATGAAAGGGGTTCATCTGAACCCCTTTCGTCGATGTTCTTATGTTTATTCC
TTCATATTCTGGCTCCGTTAATGCCAGTAAGTATCCGATAGCTCATATAAGGAGTACTTT
TTACTGCTCTAATGAGAAAAAAAAAAGGATCATATCAGCTAGTTTATCTCTGATCCTTGT
AGCATGTATCTGGTATCTGCAGTAAGCATCTTGTACATTTTCAATTGTTGTAAATGCAGC
TTTAAAAATATACATATATAACAATATCACCTATACTTCTAGTAACTACATAAGCCTGCT
GCCTATTATCAATGAAAATTTCTGAATTCCATACCA