Microarray Probes on PGSC0003DMT400046919

Probe IDChipProbe Sequence
CUST_35750_PI426222305 JHI_St_60k_v1 CTTTGTTGGAGAAACCAATGTCCTGAACTACTTAGTTACTGAATCTTCAGACTGTTCCTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400046919

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400046919 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G05390.1 +1 1e-26 105 60/133 (45%) FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT4G01240.1); Has 507 Blast hits to 498 proteins in 33 species: Archae - 4; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 493; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | chr3:1546585-1547976 REVERSE LENGTH=463

Transcript Sequence (604 bp)

>PGSC0003DMT400046919 604 pgsc_dm_v3.4
TCTAGGACTACCTCTATTTAAATCTAGGATAGAGTTACGACGCGATATGCCAACAACTTA
CTACTTGGAAATTGTGGGTTCCGTCGAGCTTCTCATAGAAATACAAAAACGTATCACCCA
CTTCCTACAATCTGGCTTGAACCTTTGGGTAGACTCTGGAAGATCAACATAGCTGCACGG
AATTCAGTAGAATTCCTCGGTACGGTTGCTAGGATGAAGGAAAGGAATGTAACCATTGTA
ACAACTTCCATGAATTTGGTTGGTCCATTCAACAGCTTCATTGCATTCAGGGGATTAATA
TCAATGCACGTTGGCGTCTCCCAGAGGCTTCCTTTCTTCAAGAATACTCTGGATATCCTG
CACTCTATTCGTATCTTGAACAATTGGATTCTGGATACCATGCTTGAGTTCACTCAATAT
GACATATACAGAGCTCTGAGGCCTGGAGGACTCTTCTGCCTGGAATCACAGTTAAATGTA
GCTTATCTTCCTATGCTAGAGCTTGATCGAGGGATCGATAAGAATGTGTGGTATTTCTCT
GCTTTGTTGGAGAAACCAATGTCCTGAACTACTTAGTTACTGAATCTTCAGACTGTTCCT
AAAA