Microarray Probes on PGSC0003DMT400046778

Probe IDChipProbe Sequence
CUST_11790_PI426222305 JHI_St_60k_v1 TTTACATGTAAAGAACAATCACCTTATGAAAACTCCCATCAATTCAAAGACGTACGCGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400046778

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400046778 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G20140.1 +3 0.0 700 417/871 (48%) Leucine-rich repeat transmembrane protein kinase | chr4:10884220-10888045 FORWARD LENGTH=1249

Transcript Sequence (3239 bp)

>PGSC0003DMT400046778 3239 pgsc_dm_v3.4
GTCAAGTTAGGACACTGTTAACTTTCCTCCTATCTCTCTTAGCAAATATATTAGCTTCAT
GCTACTCATAAGTTTCCATTTTAAGTAAAAACCAGCCCCACAAATTCTTTCATAAATTAT
GCATTTGTTAATTTAAGTTCCGAGGTTGTGTTCCATTCACAAATATTGGCATGGGAAGTG
TTCTTTTTTCTTATCTGCTGTTTTTCTTGACAGCAGTTAGTGTTGTTCTTGCTGTTTCTT
CAGCAGATGGTTCATCTGATTCGTATCGCCTTTTGAGAATAAAGTCAGAACTTGTTGATC
CAAATGGAGTTCTTGAAAACTGGTCTGAAGGGACTAACATGTGTACCTGGAATGGAGTGG
CATGTTCAGATGATAAATCTCATATTGTGAGGCTCAATCTTACTAGTTCAGGACTAGAAG
GTCAAATATCTCAAGAATTCGCGCATCTCACTTCTCTTCGAGTGATTGATCTTTCGGACA
ATTTTCTTAATGGAACAATCTCTCCTGCATTAGGAGAGCTTCATAACTTGGAGGAATTGC
TTCTTTTCTCTAATTTTCTCACTGGTGAGATTCCTTCGGATATCGGTCGTTTGAGGAAGT
TGCAAGTTCTTAGAATTGGAGCCAACATGCTGACAGGACAATTGATACCAGAAATTGGTA
AACTTTCTGAGTTGAGAGTGTTGGCTGTTGCTTATTGCCAATTCAGTGGAAAGATACCAA
ATGAGATTGGTAATTTGAAGCAGCTGATAAATCTTGACTTGCAGCAAAACAGTCTTAGTG
GCCCCATACCAGATGCAATTGGCGGCTGCAAAAATCTTCAAAATTTTGCAGCATCAAACA
ACAGGATTGAGGGAAAGATTCCTGCTTCAATTGGTCAGCTCAAATCACTCGAAATCTTGA
ACCTGGCAAACAACAGTTTTTCTGGTTCGATTCCTGTTGAGCTGAGCCATCTTTCCAATT
TGAAGTACTTGAACTTGTTTGGCAATGAATTGGAAGGAGAAATTCCTTTTGAGCTTAACA
AGTTGGTTCTGGTTGAAACATTGGATTTGTCAAACAACAACTTTTCAGGAACCATAAGGC
TTCTCAACACTCAGCTGAAGAATCTTGAGACTTTATCACTCTCTGGTAACTTCTTAACAG
GAAGCATCCCGAGTAACTTCTGTCTCCGTGATTCAAGCTTAAGCCTACTCATTCTGGCTG
ACAATAAGCTGTCTGGGAACTTCCCGTTGGAGTTATTGAACTGCACGTCCATACGACAAC
TGGATCTCTCCGGTAACAGCTTTGGAGGAATGCTGCCACGAGGCCTCGACAGGCTAGAAA
GTCTCACAGACCTCTTGCTCAACAATAACAGCTTTACTGGAACTATACCTCCTGAAATAG
GAAACTTGACTAACTTGGAAGATTTGTACCTGTTTCATAACATGCTCTCTGGTGGAATTC
CAGTTGAAATAGGAAAGCTTCAAAGGCTGCGTGAACTATACCTCTACGAAAACCAGTTGT
CAGGAAGTATTCCAAGAGAGTTGACAAACTGCTCCAGCTTAACAAGCGTTGATTTCTTCG
GTAACCAACTTTCAGGATCTATTCCTGATAACATTGGGAGGCTTAAGAATCTTGTTATTC
TTCAGCTAAGGCAGAATGAGTTGTCAGGTCCGATTCCATCAAGCTTAGGCTACTGCAGGA
AGCTTCAAAAACTGGCTTTGGCTGATAACAAACTTTCAGGATCATTGCCACCAACTTTTC
GATTTCTCTCAGAGATGGACCTGATTACTCTTTACAACAATTCCTTTGAAGGTCCACTTC
CTGAATCTCTTTCCCTTCTGAAAAATATCAGCAAAATTAACTTTTCTCACAATAAGTTCA
GTGGAAACATTTTCCCCTTAGCTGGTTTAGATTCTCTGACAGCTCTTGACTTAACAAACA
ACAGTTTCTCTGGTCCTATTCCCTCTGAGCTAGCTTTGTCAAAAAATCTAACCCGTCTTC
GCCTTGCTAATAATTTTTTCACTGGAGAACTCCCTTCTGAATTCGGACAACTTGAGGATC
TCAGGTTTCTTGATTTATCATTCAACAATTTGACCGGAAATCTAGCACCTTCCCTTGCTG
GTCTTAAAAACCTTGGTCATTTTCTCCTTAGCTCTAACCAATTCTCGGGTGAAATTCCCA
CATGGTTAGGAGGCATAGAAGATCTTGGTGAACTCGATCTTTCGTTCAACAACTTCACTG
GAACAGTTCCAACAGAACTTGGAAACTCTCCAAAGTTACTCAAACTTTCTCTAAGTTACA
ACAGATTATCAGGCCCCATACCACCAGAACTAGGCAATCTCACAAGTCTAAATGTCTTGA
ATCTTCGAAGAAACAATCTCTCTGGTTCCATCCCTTCAACTCTTCAAAAATGCCAAAAGC
TCTATGAGCTAAGGCTCTCTGAAAACAACTTAACAGGCTCAATCCCTTACGAACTTGGTT
CTTTATCCGAATTACAAGTAATACTAGACCTCAGCAAGAATCACATTTCAGGTGAAATCC
CATCATCACTTGGAAACCTTGTAAAGTTAGAAAGATTGAATCTTTCATTCAATCAACTTC
AAGGAAAAGTCCCACCATCACTTGGAAGGTTATCAAGTTTACATAGACTCAATCTTTCAT
ATAATCATCTTCAAGGCCAAATCCCTTCCACATTTTCAGGATTCCCACTAAGTTCTTTCA
TGGGAAACAATCATAACCTATGTGGCCCACCATTACTATCTTGTTCTGAACTAAAGGAAC
ATGAGAGAATTTGGGAGCTGTCAAAAGCAAGTGTTGTAGGGATAACAGTGGCTATTGTGT
TAACAGCAACAGTTATATGCATGGTTCTGCTTTATATCATGCTGAGGATTTGGTGCAATT
GGAGAAAAGTTACAATTTCTTGCTCAGAGAATGGTGGAATTGAGAGTAAAAGTAGACAAG
GGGAAAATTGGGTATATGGAGAAGAGATCAAAAGTGGACAATATTGGAATACAACATCAT
TAGTTTCATCTAAAGAGAAGCAAATATCTAAAGGGACTTGCATGTTTAATCTTAGTGTAA
GTTCATCAGATAGCACAGAAAAACCTTTAGTTTAAATTAAGAGGTGTTTTGTTTTGTTTT
GTCTCTCTACTTTGTAAATTCTTTTGTCATGTGTTGAGATTAATTTGTTTATGTGGGGGT
TTACATGTAAAGAACAATCACCTTATGAAAACTCCCATCAATTCAAAGACGTACGCGTG