Microarray Probes on PGSC0003DMT400046695

Probe IDChipProbe Sequence
CUST_11783_PI426222305 JHI_St_60k_v1 CTAGTCGGATTCTACTTCGTTGAGAAGAGAAAGGCGGTCAAAATTTCCCAGCGAAAATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400046695

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400046695 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G50200.3 +1 2e-53 177 88/179 (49%) nitrate transmembrane transporters | chr5:20436308-20437535 FORWARD LENGTH=210

Transcript Sequence (996 bp)

>PGSC0003DMT400046695 996 pgsc_dm_v3.4
ATGGCAATTAGTACTCGTGCTATTTTTGTGGCTACAATTGTCATATGTTCATTTTTGGCT
GTTTGTGATGGTGAAATATTGTTCTCTACCCTCAAGAAAGCTCTTGAAGTGAAGGCTGAC
CACAAAGCGGGCGTCTTGATGGCCGGGGAGGACATACTCACATTCAAGTGGTCCTTGAAC
ACTACACTCTCAGCAGGGGCAGATTCAGGCTACAAATCAGTAAAATTGCAGCTCTGTTAC
GCCCCCATAAGCCAAAAGGACCGTGCGTGGAGGAAAACAGAAGACCACCTTAAAAAGGAC
AAAACTTGTCAATTCAAAATTGTGACCGTACCATACAAATCCTCAAACAACAATTACACT
TGGACAATCAAGAGGGATATCCCAACAGCTACTTACTTTGTTAGAGCTTATGTTTTGAAT
GCTAATGGTGAAGAAATTGGCTATGGACAAAACACTGATGACAAAAAGCAAACTCTCCTA
ATCAATTCTTCACCTTCACAAGGACAAGTTCTGCAAGCTGGAGAAGCACAAGTGACAATA
ACATGGTCATTGAACAATAGCTACCCAACAGGTACAGACACAAATTATAAGACAGTGAAT
GTTAAATTATGTTATGCCCCAGTGAGCCAATTGGACAGAGGATGGAGAAAGTCCAACAAC
AATCTCAAAAAGGACAAAACTTGTCAAATTAACCTCGTCACCATGCCATATAAACCTTCA
AACAACAATTTCACTTGGACTATACACAAGGATGTTCCTACTGCTACCTATTTCATTAGA
GCTTATGTTTATGACTCTACTGGTGAAGTTGTTGCCTATGGCCAAACCACAGATGCTCAC
AAGAAAACCAACTTGTTCAAAATCACAGCAATCACAGGCCGACACATCACCATAGACGTA
TGCGCAGCCTGTTTCTCCGTTTTCTCCATCATCTCCCTAGTCGGATTCTACTTCGTTGAG
AAGAGAAAGGCGGTCAAAATTTCCCAGCGAAAATGA