Microarray Probes on PGSC0003DMT400046487

Probe IDChipProbe Sequence
CUST_51235_PI426222305 JHI_St_60k_v1 GGACTTAATGGAAGATTGAGAGGGCTAAATTGTCTTTGTTTGATTTTGTGGACTAATAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400046487

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400046487 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G33050.1 +1 6e-30 112 69/169 (41%) receptor like protein 26 | chr2:14021870-14024272 FORWARD LENGTH=800

Transcript Sequence (1164 bp)

>PGSC0003DMT400046487 1164 pgsc_dm_v3.4
TTTCATCAAATAACATCACCATTGATGAGGGAATGAATATCACCTTTCTTAGCCTATCAT
CTTTATTCTTATCATCTTGTGAACTGAAGGATTTTCCACACTTCTTGAGAAATGTAAAGA
CACTTGTGTACTTGGATATTTCTAACAATATGATTCGTGGTCAAATTCCTGACTGGTTTA
GTGGCATGAGGTGGGACAACTTGTGGTACCTAAATATTTCACATAATCTTTTGACAGGTT
ACCTACCACAACTGCATTTCCATAATCTAGGGTATCTTGATCTGAAATTTAACTCCCTTC
TGGGTCCACTACCTTTATCCATTTGTAACATGAGCTCGCTTATCTTATTAGATTTATCAC
GCAACAACTTCAGTAACTACAGTTTCGTATGAGGATTCATTGAGTTTGGTAATCAAAGGG
CAGGATATTGAGCTACAAAGAATCAACACAATTATGACAACCATAGATCTCTCAAGCAAC
CATTTTGAAGGTGTCATTCCGAAAACACTAAAGGATCTCAGCTCACTTTGGCTACTCAAT
TTATCCCATAACAATCTCATAGGTCATATTCCAATGGAACTAGGGCAATTGAATACGCTT
GAAGCTTTAGATCTCTCTTGGAATTGGCTCACTGGAAATATTCTGCAGGAACTGACAAGA
ATGAACTTTCTGGCCTTCTTAAACGTCTCTCAAAATCATCTTGTCGGACCAATTCCTCAC
GGTCTACAGTTCAACACATTCGAAAATGATTCGTATGGCGGAAACCTTGATTTATGTGGT
CTTCCTTTATCAAAGCAATGTGGAACGAGTGATTCATCACATGTTCCTCAACCATTGGAG
TCCGCAGAAGAAGGCAAGTCATATTTTTTTAGTAGTAATAGGCTACAGTTTTGGACTTGT
CATTGGAACTGTCATGTGGAGCCTCATGTTTAAATATCGTAAGTCAAAGTGGTTTGTGGA
AATTTTTGATGGACTCATGCCTCACAAAAGAAGAAGGCCAAAGAAGAGAGCTCAGAGACG
AAGGACTTAATGGAAGATTGAGAGGGCTAAATTGTCTTTGTTTGATTTTGTGGACTAATA
AGTAAACTGTTCTGTTTTTGTCTTCTTTTTTTTAATTTTCTATTTGTTGTTTGTATATGT
TAGAAACATAATTATATGTGTGTT