Microarray Probes on PGSC0003DMT400046207

Probe IDChipProbe Sequence
CUST_30819_PI426222305 JHI_St_60k_v1 TTTCTCCAACTGCAAAAATATCTCTGCTTTTGTTGTAGACTCTGTTTCTGTAGCTATTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400046207

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400046207 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G02380.1 +1 4e-14 67 48/96 (50%) senescence-associated gene 21 | chr4:1046414-1046807 REVERSE LENGTH=97

Transcript Sequence (820 bp)

>PGSC0003DMT400046207 820 pgsc_dm_v3.4
CATTTTCCTTCTTTCATTTATATAATATAATATACACAGCTAAGAATCGCTGCGACGCAA
AGAGATTAGAAAAAAAGTTCAAATTTGTTGCTGCGGAAGTAATTAAAGTTTCGATTTCTT
CCGTTGCAACTTTAATTTAATTTTAAACGCTTCTATTCTTAGCAAAGATCATCAATTACA
ATGGCTCGTTATTTCTCCAACTGCAAAAATATCTCTGCTTTTGTTGTAGACTCTGTTTCT
GTAGCTATTCAGAGGCGTGGATACGCGGCCGCATCACAAGGTGGTGTTTCTGGTAGTGGA
GCTGTTAGAAGCAATGTGATGGAATCAAACAAGACTTCATGGGTACCAGATCCTGTTACT
GGTTATTACAGACCAGAAAGTCATGCCAAGGAAATTGATGCTGCTGAGCTTAGAAACATG
TTGTTGAAGTACAAACCTAGACAAAATTGAAAAACAAAAAACAATTATAGGATCAAGAAT
CACGTCTCGAGGAGTAGAGACGAATTCAGGATTTGAATGTTGGAGTTCAATAGTTATACT
TTTGGAATTATGAGTTCAAAATGAATTGTTAGTGGAAATATAGTAATTTCTCACATATTA
TGTTTGTTTTCCGCATAGGAAAAATGTTGAGTTCAGTTGAATACGTTGGACCTATATTAC
ATGTGTCAGGCAGATTTAGGATTCAAATGTTCAACGTTTATGTTTTTACCATTGAATTCA
TTGTACTTTTGAAAGTATGAGTTCAGGATGTAATGTTAGTGAAAATTATAGTAATTTCTT
ACATATATGTTTGTGTTTGGTATAGAAAATTTAATTGAAC