Microarray Probes on PGSC0003DMT400045744

Probe IDChipProbe Sequence
CUST_43017_PI426222305 JHI_St_60k_v1 CTGATTTTCATCAAGCTATCACCTATGGCTTCGAGCTTTATTATATCGGGTTTATAGAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400045744

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400045744 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G38280.1 +3 1e-34 138 64/123 (52%) PR5-like receptor kinase | chr5:15293325-15295838 REVERSE LENGTH=665

Transcript Sequence (1686 bp)

>PGSC0003DMT400045744 1686 pgsc_dm_v3.4
CGTCCCCCTATCCTTCACTTTGAACTGGAATTTGTGGACTACATCAGTCTCTCTTGTTTG
CTATTTGGAAATTATTGGGAGAAGAAAATTGACTCCAGCAACTATACAATAACTCCCTCT
TCTTTCTGTTCATCCAATAGAGCTGATCTCCTTTTTAAAAACAATGTGTAGGGGAACAAA
CATTCTGCTAAAATGTTATACAATCCTCATCTTTCTTCACATTTCACAAACATGCAATGC
TTGGAACTTGAAGAGCAAACACTGTATCCCTTCTTCTTGTGGTCATATCCGTGACATAAG
CTACCCTTTTCGCTTAAACACCGATCCAAAACATTGTGGTTTCTCAGAAGCTGAATTAGC
TTGTTAAGGCAACAAAACCATTATATCACTCTTCTCCAAGAACTTGTATGTGCAAGCCAT
CAACTACGATAACCAGACAATTCGCCTGGTAGATCCAACGTTACAAAACGCTGATATGTG
CTCTCTAATACTACCTCCTCATCTTAATTCCCACCATTACAATAGTACACATTTTCGTCT
GTATTAAAATGGATCAGAGAATAGTATTAAAAGAGCAGCAGAGCCTATCTTCATGTTCAA
CTGTCCCTTTGCTATTAATACATTTCTAGAAATTAGTGGCTGCAAATTAAACAGATACAC
TTACTTAAAGATTGGAGAAATGAATGCATCAGAAGTCAGTGATGGATGCAGAGTACAACT
CGTCGGTCTGACCTCATGGCCTAATATTAAAGAGGCAGAGAACAACATTTCCCTTTCTGA
TTTTCATCAAGCTATCACCTATGGCTTCGAGCTTTATTATATCGGGTTTATAGAAAGGGA
TATTTGGATGTCACTCGGGCTGTTAATTGGGAGTTTCTTGGGTAAGCTCGTATCCCTTTA
GCAAGTTGTATTATTTGGCCGGACAGAATTAGCATTTCGTTAGTATTATGTCTGTTGGTT
TGTCATAACAATTATCATCTCTTCATTTCCACAACTCTTTTACACTTAAAGGTGACATGC
AACAGCAGGTAACTATCTATAATAAGCCTAATTTTATGGTTTACTTGGAACCAGACAAAA
TTATGCCTTAAGAGAATGTAGGAACATTCTAAGTTACTTTTCTTATTCCTGATAGTCTTT
TTGTTTCCTTAGTACAACTTCTCAAACATGTAGGGTCTTTAATACTGAAATTTATGATTG
GCCTTCCGTTCATAATTTTATTTCTGGGGTACAAATTCAAGAGGAGGCATTTGTCCATGT
ATGATGCGATTGAAGGCTTTTTGCAAACACAAAACAATTTCATGTCAATCAGATGTAACT
ACTCCCACGTAAAGAGAATGACCAGAGGATTCAAAGAGAAATTAGGTGAGGGAGGTTACG
GCAGTGTATACAAAGGAAAGCTTCAAAGTGGAAGAGATATAGCAGTGAAGATGTTGAGCA
AGCCTAAAGCTGGTGGGCAAGATTTCATGAATGAAGTAGCTACCATTGGAAGGATTCATC
ACGTCAATGTGGTTGGACTCGTGGGGTATTGTGTTGAGGGAACAAAGCGTGCTCTTGTAT
ACGACTTCATGCCCAACGGATCACTTGATAAGTACATCAGCACCAGTCAAGAAGAGAGTC
CTTAGTTAAGTTGGCAGAGGAAGTATGACATTATTCTTGGAGTGGCTGGGGGAATTGGGG
ATTTGC