Microarray Probes on PGSC0003DMT400045741

Probe IDChipProbe Sequence
CUST_43071_PI426222305 JHI_St_60k_v1 GAAAACTCTGTTGATAATCCCATCGAAGTATATATTTGTTCTGATTGAATGACCAGAGGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400045741

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400045741 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G18250.1 +1 7e-39 145 92/276 (33%) receptor serine/threonine kinase, putative | chr4:10087343-10091963 REVERSE LENGTH=853

Transcript Sequence (777 bp)

>PGSC0003DMT400045741 777 pgsc_dm_v3.4
ATGACCAGAGGATTCAAAGAGAAATTAGGTGAGGGAGGTTACGGCAGTGTATACAAAGGA
AAGCTTCAAAGTGGAAGAGATATAGCAGTGAAGATGTTGAGCAAGCCTAAAGCTGGTGGG
CAAGATTTCATGAATGAAGTAGCTACCATTGGAAGGATTCATCACGTCAATGTGGTTGGA
CTCGTGGGGTATTGTGTTGAGGGAACAAAGCGTGCTCTTGTATACGACTTCATGCCCAAC
GGATCACTTGATAAGTACATCAGCACCAATAATAATAGCATTGTGACTCTCACAACTGCT
CGCGGAACGATTGGATATGTAGCTCCAGAGTTGATCAGCAGAAGCATTGGAGCAATCTCT
TACAAAGCTGATGTTTGCAGCTTTGGAATGTTGTTAATGGAAATGCTGGACTTGAAGAGA
CATGAAGTTGCAAATGAAGAGAATTCCAGCCAATATTTTCCTTATTATATTTATGATAAG
TTCAACAAGGGGAAGGAGATCCTGGTGGATGAAAAGAAGATGGCTAGAAAGCTGAGTTTA
GTTGCATTATGGTGCATTCAGACGAATCCAATACAATGCCCTTCAATGAGTAAAGTATTA
GAAATGCTTGAAGGTGAAGGTGAAGTTGAAGTGCTAGAAGTACCTCCTCAGCCTATTCAG
TCTCAACCCATTGTTCATCAGATGATGGGAAGTTCTATGGCATTTTCGTCTGATTCAATG
GCTTTGTTAGAAAACTCTGTTGATAATCCCATCGAAGTATATATTTGTTCTGATTGA