Microarray Probes on PGSC0003DMT400045470

Probe IDChipProbe Sequence
CUST_33571_PI426222305 JHI_St_60k_v1 CTAAGTACTACTAGTTTGACTATATGAGGTGCCTTTTGACTCTTTATTAGCTTTGTTCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400045470

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400045470 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G01470.1 +3 1e-39 147 77/136 (57%) homeobox 1 | chr3:182648-184034 REVERSE LENGTH=272

Transcript Sequence (1935 bp)

>PGSC0003DMT400045470 1935 pgsc_dm_v3.4
GATAAATGAACGCTACATGGTTTAGTTTACTTGAATTGAAGTGAAGAAACTTAGTGTATT
CAAGATTTTGATACATTAGTGACCTTGTTCTTTTCTTGATTTGCTCTGTTTTAGGTTCTG
CATCAATGGTTAATTTCGAAGATGTTGGTCGAGGAGAAGTCACTAAAGAGAGGCCATTTT
TCCCTGCAATTGACAACGAAGAAACTAGCAATGATGATTATGATAGTTGTTATCATCAGC
CAGAAAAGAAGAGAAGACTTTTGCCTAATCAAGTGCAGTTTCTTGAGAAGAGTTTTGAGG
TAGACAACAAGCTTGAACCAGAGAGGAAAGTTCAATTGGCTAATGAACTTGGCTTGCAGC
CTAGGCAAATTGCTATTTGGTTTCAAAATAGGCGTGCTCGATACAAGACTAAAGTACTTG
AGAAGGACTATGATGTTTTGAAAGCTAGCTTTGATAAACTTAAAGCTGATTATGACACCC
TTTTCAAAGAGAATGAGGATTTGAGAAATGAGGTATCTTGATCATACTTCTTGTAAAACC
AGCATTCTTCATTAGCATTAGAACTTCCAAGGGGTTTGTTATGTAGCCTTGAAGAAATGA
GTTGTTGTCCCTTACATGGTCTTGAACTTTATTTGGTATTAGAGTCAGACTCATCCGTAT
TGTTGATTTGTCCAACCTAGTTGTGTCGGGGTGTTAAAAGTTGAGGAAATAGATTGTTGT
CTTGTTAATGGTCTTTGAACAATCTCTCACCTGAGGAGCTAGCTTCTGGGATTAAGTTAG
GCTTCAATGTCATTTCCTTAACTTGGTATTAGAGTCAAACTCATCCGTATTCTTGGTTCA
TCCATAGGCACGCCGGAGTGTTAAAAGTTAAGCGAATAGCTTGTTGTCTCCTTAATGATC
TTTGAACAATCCTCGTCCGAGAGGCTAGTTCTGAGAGTAAGTTAGGGCTCACCTTTATTT
TCTTAACATGGTATTAGAGTCGGACTCATCCGTATTCTTGGTTTATCCGTAGGCGTGTCA
GAGTGTTATAAGTTAAGCGAATAGCTTGTTGTCTCCCTACTGGTCTTTCAACAATCTTCA
CCTCTAGAGATAGCTTCTGGGGTTGAGTTGAGTTACGCATAACGTCCATTTTCTTAGCGG
GATTTCTAATATATTCTTTGATTTTGTTGAATAGGTCCATTTGCTTACACAAAAATTGCA
TAGGAAGGAGAAAGGGAAGGAAAACTCAGAACAAAGTGTACCAATTAGTCCAATAGATAC
ACAAGAGGCTCAAAAGACAACAACTCCAATAGTTGTTACCTCAGATGTACCAAGTATACC
AAAGTTAATGTGCAAACAAGAAGATGCAACTTCAGCAAAAAGTGATGTTATTGATTCAAA
TAGCCCACATTATACTGATGGGAATCATTCATCAAATGTATTTGAACAAGAGCCATCTGA
TTTTTCTCAAGATGAAGATGACAATCTAAGCAAGAGCTTTTTATGTTTCCCAGAAATTGG
AGATCAAATTCAAGCTAATTCATGCAATTTGAGTTTCCAAATTGAAGATCAGCCTTGTTG
GTTCTGGCAATATTGAGTTATTAGGTTTCAAGATTGGCTCAATCCTACTTTAGTGTTCCA
AAGCAATCAGTATAATTTCACAAATGGAGTCTGAAGACAATTGTGTGTACACATGCACGT
ACATAGTCTTATCTCTATCTTGTGGTACAGGTAGAGAGACTATTTCCGATAGACCCTCGT
ACGAATTTAGAGGTCCAAGGCATTTGCTAAATTTCTTTGAACAATAATATGTTGTACATA
GGATTACTAAGTACTACTAGTTTGACTATATGAGGTGCCTTTTGACTCTTTATTAGCTTT
GTTCCAAAAAAAGTTGTGATTGGCCTTTTTTTTTCACTTTAGCTAAAACACAAATGGTAC
TATTGCCTTTTTTTC