Microarray Probes on PGSC0003DMT400044890

Probe IDChipProbe Sequence
CUST_34257_PI426222305 JHI_St_60k_v1 CCTTTTGTACGTGTTATCGATTGGTTATTGATTTGTAACGATTTGGTTATCGGTTTAACC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044890

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400044890 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G12680.1 +2 2e-112 357 185/295 (63%) unknown protein; INVOLVED IN: vegetative to reproductive phase transition of meristem; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40640.1); Has 103 Blast hits to 103 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr4:7475104-7478174 FORWARD LENGTH=575

Transcript Sequence (2402 bp)

>PGSC0003DMT400044890 2402 pgsc_dm_v3.4
CACCTTTAAGAATATTCTTTGTATAAATAAAATTAATTTGGACATGGGTTCTTGATTTTG
ATCAACTTCATTGAACCATAATAGTGAAGGTTTTTGTTTTTTGATGGAAGTACCAGTAGG
GTTCTTGGCTAAGCTTTGGAGCTTTATATCTTTTCTTCCTTTCTTCTTCTTGCTCTTCCT
TCTTGGTCTTCTCAAAGGATTAGTAATTGGCCCCGTTGTGACTGTCCTCATATCAGTTGG
GAATTCAGCAGTTGTAATTGGGCTATGGCCTGCACATTTAATCTGGACTTACTATTGTGT
AGCAAAAAGCAAGAGACTTGGATGGGTTTTGAAGATTGCATTACTGGTTTCATTGCCAGT
TCCTCTGATTCTTTGGCCCATAGTAGCCATTATTGGGAGTCTTCTAGGTGGGATAGGGTA
CGGTTTTTTCGCTCCTTTGATAGCAACTTTCGAGGCTATTGGAGAGAGTATCACTTGCAA
GATCTATCACTGCTTCACGGATGGTTGTATTTCCACTCTTAAAAGGAGCTGCACGGTAGT
TCGAGACTTTACAGACTTTTGCTTCCACTCTTATTTTTCTTATATGGACGAGCTTTCTGA
GGAAATATATCCAGATGAGAAACCAATAGAAGTGAAGTGAGTGATATCTGAACCTCTTTT
TAAAAAACATTAGACACAGATGGTAGATTACAGTGTACCATATTTTCATTATCGTGCTGT
GTCCTAGGTTGTCAAAGCTGCCAAGTTGCATTTTGGTTTCTCTGCTTGCGATTCCAGTGG
ATGTCCCTCTTATTACAGCTCTTGCTCTTTGGAAGAGCCCATTCATGCTGTTCAGGGGCT
GGAAGAGGCTACTAGAAGACTTAATTGGGAGAGAAGGCCCATTTCTGGAGACTGTTTGTG
TACCTTTTGCTGGCCTTGCAATCTTTTTGTGGCCTTTAGCTGTTGTTGGATCCGTGGTAG
CGTCCTTCTTTTCAAGTTTTGCTCTTGCACTTTACAGCGGGGTTGTGGTTCATCAGGTCT
ATATGCTCTCCTCCTTCCTCTGTTTTACTAAGTAATCATATGAGCCAGCTTTGAAGTTTG
AGAGGCACTATGTCTCATTTAGAACGTTGTCTGATTCTTACTGAAGTGACACGAGTTTTG
CTAGGAAGACTCGTTTCGCATGGGACTTGCATACATCCTAGCAGCCGTTTCCATATTTGA
CGAATACACAAACGACCTACTTGACATGAGGGAAGGGTCATGCTTCATGAGGCCTAAATA
TAGAAGAAATATGATCTCCTCTGGAGGCCTTGACAGTAAGAAGTTAATTGAGCAGAGGAA
GGAAAAAGAAAAAGAAGGATCACGCAGTTTGAAGCTTGTTTCGCATGGATCACGAACGCT
GAAACAGGCAATCCAACAATATACGCCCATGCAGGTATGGGGTTGGCTCTTTAAATCCTG
TGAGGTCAATGGCAGAATACTCCTGCGTGAAGGCTTTATAGATGTCAAAGATATTGAGGA
ATGTATTGTCAAGGGGGACTGTAAGAAGTTAGGTATCAAATTGCCTGCTTGGTCCATTCT
ACAGTGTCTGCTTGCATCCGCACAGTCCGACTCTCTGGGCCTACTAATTTCTGATGAAGT
GGAACTGACAAAGTCTAACTGGCCAAAGGATAAAGTGTTTGAGTGGTTCCTTGCGCCTCT
CTTAGTCATTAAGGAGCAAATAAAAACACTACAATTAGGAGAAGATGAGGAAATTAGTCT
GAGGAAGTTGATAATGTGTTACAAAAATGAAAGGCCAGAGGAATGGGACAACACCGGATT
TCCATCCACCGATACTGTGAGGAGAGCACAGTTGCAAGCTGTTATTAGGAGGTTGCAGGG
CATTGTTGGTTCATTTTCTCGGGTACCGACATTCAGAAGACGCTTCAAGAATTTGGTGAA
GGTGTTGTATTTGGAAGCAATCCAGACTGGTCTTATTGCCGAAACTGATGGTGGAAGCTC
AAAAGCTGGAAATAGAAATAGGCATCAACGTGTAAAGGGGGATAAGAACAATACAGATGA
TGACGGAGAGCAAAACGAGCAAAGCAGCCGAGATGGTGATAGTATTGTGTGACCATTCCT
GTAGGTAAGATCATGTAATCTCTGTAGTACTTAGGCAGGTATTAGCCGAGAATCGAGATG
GTGATAGTATCGCGTACATTTTCGATATTGAATGAGCTACCTTTTGTTTTAGCTTCTGTA
TTTTCTGGTGTAGGAACCATAGTAAATGCAGTTTGGCTCTGAGGAGTTGATTTCATTTAC
CGACTGAAGTCATAAAGCAATTGTTGTAAACTAACATGCATCTATGAATTAGCCTTTTGT
ACGTGTTATCGATTGGTTATTGATTTGTAACGATTTGGTTATCGGTTTAACCAATAAAAA
AT