Microarray Probes on PGSC0003DMT400044818

Probe IDChipProbe Sequence
CUST_34231_PI426222305 JHI_St_60k_v1 CTTGTTGTGTTACATCCTGGGCTATATTTTGCTAATGACTAATAATATACCCTACTCTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044818

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400044818 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G35790.1 +1 0.0 871 429/529 (81%) glucose-6-phosphate dehydrogenase 1 | chr5:13956879-13959686 REVERSE LENGTH=576

Transcript Sequence (2153 bp)

>PGSC0003DMT400044818 2153 pgsc_dm_v3.4
TCCAATAATATCCTCAACAACAGATAAACTCATCTTTTTTTTAAAAAAAAAAAAAATTAA
AAAAATTCATCAAGAAAACTCATTCTTGAAAAAAGGCATTTCTCTGTCTGTATGGGTGTG
CAATTGAGATTGAACCCTTGTTCTTCATCTTCAGCTGCAACTTCTCCATCAACTTTCCAT
AATGGGACACCATATTTCTGCAAAAAGTTTAACTTTTTACCATTTAGAACCCAACCCCTC
AATTGGGTATCTGGAATTTACTCAAGAATCCAACCAAGAAAGCATTTTGAAGTCTTTTCC
TCAAATGGGTTTCCACTTAATGCTGTGTCTGTGCAAGATGTACAAGTGCCTTTGACAGAG
TTAGGAAGTGGAGATACCACTGTCAGCATAACTGTTATTGGAGCTTCAGGTGACCTAGCC
AAGAAGAAGATTTTTCCAGCTTTATTTGCTCTTTTCTACGAAGATTGTCTGCCTGAGAAT
TTTGTAGTTTTTGGCTACTCACGAACAAAATTGAGTGATGAAGAGCTGAGAAATATGATC
AGTACAACCTTAACTTGTCGAATTGATAAGAGAGAGAATTGCGATGCCAAAATGGAGCAT
TTTCTGGAAAGATGCTTTTATCATTCGGGTCAGTACAATTCTGAGGATGATTTTGCAGAA
CTGGATTACAAATTAAAGGAAAAGGAGGGTTGTAGGGTTTCTAATAGGTTGTTTTACTTA
TCAATACCTCCAAATATATTCGTGGATGTGGTGCGATGTGCAAGTCTTAAAGCTTCTTCA
ACAAGTGGGTGGACAAGGGTCATTGTTGAGAAACCATTTGGTCGTGATTTAGAATCATCT
AGTGAGCTGACCAGATCCCTAAAGAAGTACCTAACTGAGGAGCAAATTTTCCGAATTGAC
CATTACTTGGGAAAGGAACTTGTTGAGAATCTCTCAGTTCTTCGGTTCTCGAATCTTGTC
TTTGAGCCTCTTTGGTCCAGAAACTACATCCGCAATGTCCAATTTATATTTTCCGAAGAT
TTTGGTACCGAGGGACGAGGAGGGTACTTTGACCACTACGGCATCATCCGTGATATTATG
CAAAATCATCTCCTTCAAATATTAGCATTGTTTGCTATGGAAACACCTGTCAGCTTGGAT
GCTGAGGACATCAGAAATGAGAAGGTTAAAGTTTTAAGGTCAATGAGGCCATTGCAACTT
GAAGATGTTGTTCTTGGACAGTATAAGGGTCATAGCAATGGTGCTAAATCATATCCAGCT
TACACAGATGATCCAACTGTGCCAAATGGCAGTATCACTCCAACATTTTCTGCTGCTGCA
CTCTTCATTGATAATGCACGTTGGGACGGGGTTCCTTTCCTCATGAAAGCAGGAAAAGCT
CTCCATACGAAGAGGGCAGAGATCAGGGTCCAGTTCAGACATGTTCCCGGAAATTTGTAC
AAAAGGAACTTTGGAACTGACATGGATAAAGCAACCAATGAGCTAGTTCTGCGCCTACAA
CCTGATGAAGCCATATATCTGAAAATTAACAACAAGGTCCCTGGTCTTGGGATGAGACTT
GACCGGAGTGACCTTAATCTTCTTTATAAAGCAAAGTATCGAGGTGAAATACCAGATGCA
TATGAGCGGCTTTTGTTAGATGCAATAGAAGGAGAGCGAAGATTGTTCATAAGAAGCGAT
GAACTTGATGCTGCATGGGCTCTATTTACACCGTTGCTGAAGGAGCTGGAAGAGAAGAAG
ATTGCACCAGAGCTTTATCCATACGGAAGTAGGGGGCCAGTGGGAGCACATTATCTAGCT
GCAAAGCACAACGTTCGTTGGGGAGATCTATCTGGTGATGATTGATTGTATGTGAGATCT
TCTTGAGGAGTACTATGAAATGGAGGAAATCTCTAATTTCCTCACAAAGGGGGACAATTG
ATATTCATTTAGTTTTATAGGAATTGATCTACTTGCTGTTTCAGCTCATCAAGAATGCAA
AAATTATGGACAACTTGGAACTGCTGTCAGCAATTGTTGTATAGCTAGCTTGTCTATTTT
GTTAAGAAAATACTCATGTTTTATTCTTCTTGTTGTGTTACATCCTGGGCTATATTTTGC
TAATGACTAATAATATACCCTACTCTTCAATTTTACTTCTTACTTCGTTTGAT