Microarray Probes on PGSC0003DMT400044672

Probe IDChipProbe Sequence
CUST_19018_PI426222305 JHI_St_60k_v1 TATATCAGTTTTGCAGATTCAACTCCTTTATTGCCTTCGATCCTATCAGGTCCAAGGTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044672

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400044672 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G32300.1 +1 2e-113 362 236/635 (37%) S-domain-2 5 | chr4:15599970-15602435 FORWARD LENGTH=821

Transcript Sequence (1926 bp)

>PGSC0003DMT400044672 1926 pgsc_dm_v3.4
ATGAAGCTAACAGCAAGTGTTTCAACAACAAATTGGACTGAGAGAGGTTTGTTTTCTCTC
TCTTTTACCGATGATGGTTTTGTTGCTTTGGTAGAGTCAAATCCTCCCCAAACATACTTT
GACGTGACTATTGGAAGATTGAATGCAAGTAGAGGCTCAAATTATGTTGTGTATTTGAAT
GGTAGTCTAGCTTTACTCTCAAACTCTAGTAATTCCAGCAATTCACAGACACTGGTTTCA
TTTAGTCTAGCGACCTCAGCTCAATATATGAGACTGGAGTCTGATGGACACTTGAAAGTG
TATGAGTGGCAAAGTGGGTGGACTGAGATGGATGATCTCCTCACAGGTTTTAACGGCGAG
TGTTATTACCCCATGGCCTGTGGAAGATATGGCATTTGCTCAAGGGGGCAGTGCAGTTGT
CCCAAATCGAGCTCTAATTCAACGACCTATTTCAGACAGATAGATGATAGGCAGGGTAAT
CTGGGTTGCTCTGAGGTCACAAGGCTGACATGTAATGCTTCAAGTAACCACAGATTTTTG
GATCTTCAAGATGTGGACTATTTCACGTTTACGACAGATATCAGAAACACTAGTATGAAT
ACCTGTAAAGATGCATGTTTGAGGAACTGTTCCTGTAAAGCTGCTTTGTTTCGCAGTGGT
TTAAACTCATCCACGGGAGACTGCTACCTACCATCCGAGATCTTTTCACTAGCGAATAAT
GAGAAGGACAAGACAAGGTATGATTCCCATGCATTTATAAAAGTACAGGTTGAACCTGAA
ATAGCTGCTGCTAAAGAGAAAAGGCGTGTTAATGGTGCTATACTGGGCTCTGTTATAGGA
GTTTCCATCTTAGGGATCATAGTTGGAATTGCAGTTTTCATATTCTGGAAGAAGAAGAGA
AAGGCCAATGAAGATGAGGAGGATTATCTAGATCACGTACCAGGAATGCCGACTAGATTT
TCATACGATGATCTAAAGGCTGCAACGGAGAACTTCACCAAGAAGCTTGGTCAAGGAGGA
TTTGGGTCAGTTTTTGAAGGGTGCTTAGCAGATGGCACAAAGATTGCAGTGAAATGTCTT
GATGGAATAGGACAAGTCAAAGCGTCATTCTTAGCTGAGGTTGAAACTATTGGCAGCATA
CATCATGTAAACTTGGTGCAATTGATTGGCTTCTGCGCTGAGAAATCTCATAGGCTTTTA
GTATACGAGTGCATGAGCAACGGATCACTAGAAAAATGGATCTACCATGGGAAACAGGAG
CAAACTCTAGATTGGAACTGCAGGAGGAAGATTATTCAAGACATAGCCAAAGGATTAGCC
TACCTTCACGAAGAATGCAGGCAAAAGATTCTGCATTTGGATATTAAGCCCCCAAACATA
CTATTGGATGAGAAGTACAACGCTAAACTTGCTGACTTTGGGCTTTCAAAGCTAATTGAT
CGGAATCAGAGCCAAGTTATGACTCAGATGAGAGGCACTCCTGGTTATTTGGCTCCTGAA
TGGCTTAGTGGAGTCATAACAGAGAAGGTAGATGTCTACAGCTTTGGCATTGTGCTCTTG
GAAATTTTGAGTGGAAGAAGACATTTTGAAGCATCGGAGTCTGAAGACCAACAGGTAATG
GTGAACTTATTCAGGAGAAAGGCAGAGGAAGGGAAGTTGGTGGATCTTATTGATAAGCAC
AGTGAAGATATGCAGTTTTACAAAGAAGAAGTAGTAAAGGCGATGCAGATTGCTGCCTGG
TGTTTACAAAGCGATTTCACGAAGAGGCCATCAATGTCGATGGTGGTCAAGGCCATGGAG
GGTGTTATAGATGTTGACAAGGATCTAGACTACAGCTTTAGACCACAAACTGTTTCCGCA
ATACCATATATCAGTTTTGCAGATTCAACTCCTTTATTGCCTTCGATCCTATCAGGTCCA
AGGTGA