Microarray Probes on PGSC0003DMT400044601

Probe IDChipProbe Sequence
CUST_18898_PI426222305 JHI_St_60k_v1 CCCAATTCATCAAGGGGTTAGTTTAAACATCAGGTACGAATAAGTTCTTACCCTTGAGCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044601

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400044601 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G30950.1 +1 0.0 990 590/685 (86%) FtsH extracellular protease family | chr2:13174692-13177064 FORWARD LENGTH=695

Transcript Sequence (2620 bp)

>PGSC0003DMT400044601 2620 pgsc_dm_v3.4
GAAAATCTGCCATGAAAATCCAAAAACATTCTCAGAAAATATATCTCAGAATCATCCATT
GAGATAAAGCCACGTACCCAAATCCCAAGCCACATCTGTAACCTCTAAATTAACCTTACG
ACTCATCTTCTTCATCATCATCTTCTTCCCTTACAACCCTTTCTGTTACTGAGTAATCTT
CCCTCTTTCAACTTATCAGATTTATCATTAGAAGTGAACTGTGCAGGTTCTTGCTTCTTT
TCTGAGTGTATCAACATGGCTACTTCATCAGTATGCATAGCAGGAAATGATTTGTTTACC
CATAGAACACAGAAAGTTTTTAGGAAGGAGATCTATGGCAGAAAAATTTCATACTCCTCA
AATCTTCCATCATCTAGAAAAACATCAAGAGTAGTTGTAAAAGCATCCCTTCAGCAAGGG
CCACATGAAGGAAGAAGAGGCTTTCTCAAATTATTGCTTGGAAATGTTGGGCTTGGAGTG
CCTGCTTTGTTAGGTAATGGGAAAGCCTATGCTGATGAGCAAGGTGTTTCTAACTCAAGG
ATGTCTTATTCTAGATTTTTGGAGTATCTGGACAAGGATAGGGTGCAAAAAGTAGATTTG
TTTGAAAACGGAACCATAGCTATTGTAGAAGCTGTATCTCCAGAATTGGGAAACCGGGTG
CAAAGAGTTAGGGTACAACTACCTGGACTCAGCCAGGAACTCCTTCAAAAGTTCCGGGAA
AAGAACATTGATTTTGCTGCTCACAATGCTCAAGAGGACTCAGGTTCTCTCATATTCAAC
TTGATTGGAAATCTGGCTTTCCCGCTTATTTTGATTGGTGGTCTTTTCCTGCTATCAAGG
CGGTCTAACGGAGGAATGGGAGGTCCTGGTGGGCCTGGTAACCCACTAGCATTTGGTCAA
TCAAAGGCTAAGTTCCAAATGGAGCCAAACACTGGTGTGACATTTGATGATGTTGCTGGT
GTAGATGAAGCAAAACAAGATTTTATGGAGGTCGTAGAATTTTTGAAGAAACCTGAGAGA
TTTACTGCAGTGGGGGCTCGTATTCCAAAAGGTGTTCTTCTTGTTGGTCCTCCTGGTACT
GGGAAAACCTTGCTAGCAAAGGCAATTGCTGGTGAAGCAGGTGTTCCATTTTTCTCAATT
TCAGGCTCAGAATTCGTTGAGATGTTTGTTGGTGTTGGAGCCTCTCGAGTCCGTGATCTT
TTCAAGAAGGCCAAGGAAAATGCTCCTTGCATTGTATTTGTTGATGAAATTGATGCTGTT
GGGCGGCAAAGAGGGACTGGAATTGGAGGAGGAAATGATGAAAGGGAACAGACCCTGAAC
CAACTATTGACTGAAATGGATGGTTTCGAAGGAAATACTGGTATAATAGTTGTTGCGGCA
ACCAATCGTGCAGATATTCTTGACTCTGCTTTGCTGAGGCCAGGACGATTTGATAGACAA
GTATCCGTGGATGTTCCAGACATCAAGGGAAGAACAGAGATCTTAAAGGTTCATGCCGGC
AACAAGAAGTTTGATTCAGATGTGTCTCTTGAAGTCATAGCCATGAGGACACCTGGTTTC
AGTGGAGCAGATCTTGCTAACCTCTTAAATGAAGCAGCCATTCTTGCAGGTCGACGTGGT
AAGACAGCAATCGCATCCAAAGAGATTGATGATTCAATTGATAGGATAGTGGCTGGTATG
GAAGGAACAGTCATGACTGATGGCAAGAGCAAGAGTCTGGTGGCATATCATGAAGTTGGA
CATGCCATCTGTGGAACTCTCACTCCAGGGCATGATGCTGTACAAAAGGTCACTCTAATC
CCACGTGGTCAGGCAAAAGGTTTGACCTGGTTCATTCCTGCAGATGACCCAACCTTAATA
TCCAAGCAGCAACTCTTTGCTAGAATTGTTGGTGGACTTGGTGGAAGAGCTGCAGAAGAA
GTGATCTTTGGTGAACCTGAAGTGACCACTGGTGCTGCTGGTGATTTGCAGCAGATCACT
GGTTTGGCAAAACAGATGGTTGTCACTTTTGGGATGTCTGAACTTGGCCCATGGTCACTC
ATGGATACTTCAGCCCAAAGTGGTGATGTAATCATGAGAATGATGGCCAGGAACTCAATG
TCAGAAAAGCTAGCTGAAGACATTGATGTTGCTGTGAAGAAGCTTTCAGACAGAGCATAT
GAGATTGCATTGAGCCAAATCCGCAGCAACCGTGAAGCAATTGATAAGATTGTGGAAGTC
CTTCTTGAAAAGGAGACGATGACTGGAGATGAATTCCGTGCTATTCTCTCAGAATTTGTT
GAAATTCCTGCTGAAAACCGCGTCCCTGCTGCTGTACCTACCCCAGCAGCTGTATAATAG
CTTGAACATATACTGCAACTTGTACAATTCATATACACTTATCCACCTAATTGATCTAGA
GTATAAACAATAGACTATAAGAAAGTTAAAACACTTTTGTGCATTTGTGTTGGAAGCAAT
TTTTCACATTTGAAATAGAATTAGTCTTTTCTTCATTGTAATGCTATGAGTTGTTTCCCT
TGCTTTGAGCATTACTCAGTGCACAAACTCCTTGTCACGACCCAATTCATCAAGGGGTTA
GTTTAAACATCAGGTACGAATAAGTTCTTACCCTTGAGCC