Microarray Probes on PGSC0003DMT400044514

Probe IDChipProbe Sequence
CUST_19021_PI426222305 JHI_St_60k_v1 CCCAGTATGGTGCTCCTCTTATATTGCATAGATTGTAAGCTATAGCATAATTAAGTTGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044514

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400044514 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14690.1 +2 0.0 604 290/512 (57%) cytochrome P450, family 72, subfamily A, polypeptide 15 | chr3:4937410-4939310 FORWARD LENGTH=512

Transcript Sequence (1864 bp)

>PGSC0003DMT400044514 1864 pgsc_dm_v3.4
TTTAAACAAAAGCTATTGAGGTCAGACGAACTTGTATCTAGACTTCTACCTCTGCCCTCG
AATATGAGGTCCCTTCTTAACTTAAACATTATAAATAAGTCATTCAATTCCTTAGGGGAA
ATATATACATAAAGTAATGGAGATTGTTGCTTACTACTTAGTTTCATTTTTATTAACAAT
AACTATAGTAATATATGCATGGAAGTTGTTAGATTGGGCATGGTTTAGGCCAAGGAAACT
AGAAAAGTGCCTAAGAAAACAAGGTCTCAAAGGGAACTCTTACAAATTAATTTTTGGAGA
TCTCAAAGAGTTAGCCAAAAGCTTTGAAGATGCCAACTCCAAGCCATTGAAAGTCTCTGA
TGATGATATATGTCCTAGAATTGTTCCTTATTTTGTTGATACAATCAAGAAACATGGTAA
AAATTGTTTTATATGGATTGGGCCAAAGCCTATGGTATTAGTAAGGGAACCTGAGGTAAT
AAGAGATGTGTTTAACAAATATGTTCTCTACCAAAAGCCTAAATCAACTCCCATCACCAA
GTTGCTAGCACAAGGAGTTTCAAGCTATGAAGAGGATAAATGGGAAATGCATAGAAAAAT
CCTCAATCCTGCTTTCCATATGGAGAAGATTAAGAGTATGGTTCCAGCAGTTCATTTGAG
TTGCACTGAAATGGTGAGCCAATGGGAGGAGTCAATCTCAACGAAAGGAACATCTTGCGA
AATCGATATATGGCCTTACCTTCAAAGATTGACTAGTGATGTGATTTCTAGAACAGCCTT
TGGAAGCAATTATGAAGAAGGTCGAAAGATATTTGAGCTTCAAAAAGAACTAGCCCAGCA
TGTCATTGAAGCTACTCGTACCTTATATATTCCAGGATCAAGGTTTTTGCCAACTAAGAA
AAATAGAAGGATGAAGGAGATTGACAAAAAAGTTCAAGCAATGATTAGAGGAATAATTGA
TAAAAGAGTGAAGGCATTGAAAGCAGGGGAGGCCAATACTGATGACTTATTAGGCATGTT
GTTGGAATCCAACTTTAAACAAATTGAACAACATGGCAACAAGGATTTTGGTATGACTAC
ACGAGAGATCATCGAGGAGTGTAAATTGTTCTATTTTGCCGGACAAGAAACCACCTCTGT
ATTGCTTGGATGGGCTATGATTTTGTTGAGTAAGCATCCAGACTGGCAAGCTCACGCTAG
AGAAGAGGTTTTGCAAGTTTTCGGTGATGGCAAACTAGAATTTGATGGATTAAACCGCTT
AAAAATTGTGACAATGATTTTGAACGAGACGTTAAGGCTATATCCACCAGTTGATGCAAC
TAGTCGAAAAACTACAACCAATACCAAGCTAGGGGAACTAAGTTTACCAGCTGGAGTGAT
GCTCTTATTGCCAATAATTTTATTGCATCATGACAAGGAAATATGGGGCGAAGATGCAAC
AGAGTTCAAGCCAGAGAGATTTAGTGAAGGCGTTTCAAAGGCAACAAAGGGTCAAATGAC
GTTTTTCCCATTTGGCGGAGGACCTCGGATCTGTATTGGGCTAAACTTCGCGATGATAGA
AGCAAAGATGGCTTTGGCTATGATTCTACAACACTTCTCCTTTGAGCTATCTCCTTCTTA
TACACACGCTCCGCAGTCTGTAATAACTATTCAACCCCAGTATGGTGCTCCTCTTATATT
GCATAGATTGTAAGCTATAGCATAATTAAGTTGTAATATTTTTCAGCTTTGGTCTTCACT
TTTGTTCGATAATAAGTCTACATTATCAATAAGTACATGTAATTTGTTTAGGTTGAATGA
TCGATGTTAAGGAATTTTTCTCAACTAGATTTGTCTCATCTTTTTTATATAGTCAATGTT
AAAG