Microarray Probes on PGSC0003DMT400044098

Probe IDChipProbe Sequence
CUST_44879_PI426222305 JHI_St_60k_v1 GTATGGGATACCAACATCAAGTATTCTCAAGGCAGGGGCATTGGCATTGTTGTTAGTCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044098

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400044098 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G32530.1 +1 0.0 654 370/766 (48%) cellulose synthase-like B3 | chr2:13809283-13813487 FORWARD LENGTH=755

Transcript Sequence (2422 bp)

>PGSC0003DMT400044098 2422 pgsc_dm_v3.4
ACTCATTTCCCATAAGTAGTTTTTGTATATCTTGTTTCTCCATTATTATTAATGGCTCCC
AAAACACCTTCTTCTCTTCCTCTTTATGAAATTAAGTATAGAAAAAACTATATATCAAGA
GTAATAGAACTCTTCATTCTTTTCCTTTTGTTCTCACTTTTGGCCTATAGATTCCTCACT
CTAAAATTTCATGGTTTACAATGGCTCTTGGCTCTTATATGTGAATCATGGTTCACTTTC
ATTTGGATTCTCACCGTTAGCTCAAAATGGAATCAAGTTGAACCAACAACATATCCTCTA
CGCCTTTTGGAACGGACTTTGAAGTTTCCAGCTGTGGACATATTTGTTACAACAGCAGAT
CCCGTCCTAGAACCGCCTCTCATAACGATAAACACCGTGTTATCGTTGTTAGCGGTGGAT
TATCCGGCTAATAAGCTAGCTTGTTATGTCTCAGACGATGGTGCATCAATTGTTACGTAT
TATTCACTTGTTGAAGCATCAAAATTTGCTAAGCATTGGGTTCCTTTTTGTAAGAAATAT
AATATTGCCCTTAGAGCCCCTTTTCGATATTTTAGTGGTAACTCATCACCACCACAAGAT
AGTTCACAAGAGTTTCAACAAGATTGGACAAGAATGAAGGATGAATATAAACAGTTGTGT
AAAAAGATAGAAGACGCAAGTACTCAAGAACCAGAGACATGTGATTTTGATGTTTTCTCA
AATATCCAACAAAAAAATCATCCGACCATTATAAAGGTTATATTGGAGAACAAGGAGGGT
GTTGCTGATGGATTGCCTCATCTTGTGTACATCTCTAGAGAGAAGCGACCAAAACATCCA
CATCAATTCAAAGCCGGCGCCATGAATGTTCTGACTAGAGTATCTGGAGTGATGACAAAT
GCACCATTCATGCTAAATGTGGATTGTGACATGTATGCAAATAACCCACAAGTTGTTCTA
CATGCCATGTGTTATTTTCTTGGTGCTAAGGACGAGATAGACTGTGGCTTTGTTCAATTT
CCACAATTCTTTTATGATGGATTGAAAGAAGATCCTTATGGAAATCAATTAAAAGTTTTA
CACGAGTATTTTGGAAGAGGAATTAGTGGTATTCAAGGGCCATTTTATCAAGGATCGGGA
TGTTTCCATAGACGAAAAGTTATATATGGCTCGTCACCATATGAAAAAATAACTGCAGGA
GAATTGAAGGATGAGTATATACAGAAAACTTATGGAATGTCAGAGAAGTTATCAACATCA
ATTGCTAAGACTCTCTTAGAAGGATCAAATATTATTGAGCAATTCAATTCTGATTCTCCC
TCAAGTTCCATTGAGATAGCACATCAAGTTGGAAGCTGTGGATTTGAATTTGGCACTGCT
TGGGGTCAAAAGTTGGGCTGGCTATATGGTAGTGTAGCAGAAGATATCCTTACTGGACTC
TTTATCCAATCAAGAGGCTGGAAATCCGCCTACTGTTTACCCGACCCGCCTGCCTTTCTT
GGATGTGCACCTGCAGCTGGGCCTGCCTCAATGATCCAACAAAAAAGATGGGCTACTGGG
CTTTTTGAAGTTCTCCTTAACAGTAAAAGCCCAATTATTGGAACCCTTTTTGGGAAGCTT
CAATTGAGACAATGCATGGCTTATTTGCAGATCCAATTATGGGGCTTGAGATCCATTTTT
GAAGTTTGTTATGCTATTCTGCCTGCATATTGCCTCATCACCAATTCCCACTTTTTACCC
CAGGCAAATGAACTAAGTATAGTTATACCAGCATCAATCTTTATTATCTACAATCTATAT
GTTTTATCAGAGTATATTAGAGCAAATGAACCAATAATAGCATGGATGAACAATCAAAGA
ATGTGGAGGGTTAATGCTATGAGTGCATGGCTATTTGGTATTCTAAGTGCTACAACTAAA
TTACTTGGATTTTCTGAGACTGCATTTGAAATTACAAAAAAGGACCAAAATGACACAAAT
TCTGATATTGGAAGGTTCACATTTGATGATTCTCCAATTTTTGTGCCTGGAACTGCAGTT
CTCTTATTGAATCTTAGTGCCTTGTTTATTGGAGTGTTGGATTTTAAGAAAGGGAATAAT
ATTGAATGGGGATTAGGAGAAGTTATATGCATTATGTGGATTGTTTTTGTATTTTGGGCA
TTTTTGAAGGGCTTATTTGCTAAAGGAAAGTATGGGATACCAACATCAAGTATTCTCAAG
GCAGGGGCATTGGCATTGTTGTTAGTCCATCTTTTCAAATTTAAACAATAAATTGTAAGA
ATATAATTTTAGATGTTACTTTTGAATGTTTGGAAGAATATCTTGTAATTGAATTTAAGT
GTAAGTGTAATTATATAATATAACTCTTTGTTTAGTCAAATATTTATTTGGCTATCATGA
AATTGATGTAATTGAGGATAGC