Microarray Probes on PGSC0003DMT400043659

Probe IDChipProbe Sequence
CUST_38364_PI426222305 JHI_St_60k_v1 GTAGGATTTTTTGCAAGAAATAAGCGCACACAACTGTTGTCTGTTTTTCGAAAATCTTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043659

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043659 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G02450.1 +1 3e-36 133 67/142 (47%) HSP20-like chaperones superfamily protein | chr4:1073987-1075765 REVERSE LENGTH=241

Transcript Sequence (1027 bp)

>PGSC0003DMT400043659 1027 pgsc_dm_v3.4
AGGCAATAGAAGTATCTAGAAATTTGCAACATCACACCTTCAAATTTCGAAACCTTCAGT
ATATAATCAAAACCTAGCAATTTCAAAACGGCACATACATACATCTGCTCTCTCAATTTT
CGTCTCCCCCAAAACACTAACAACATCATGAGCCGACATCCTACTATCAAGTGGGCCCAG
AGGTCTGACAAGGTGTTTATCACAGTTGAGTTACCTGATGCCAAGAATGTAAAGCAGAAA
CTAGAACCAGAAGGAAAATTCTCTTTTTCTGCAACTGCTGGAGCTGATAATGTTCCATAT
GAAGTCGTTCTTGATCTCTTTGATAAAATAGATGTCGATGAGAGCAAATCTAGTATTACA
TCTAGAAATATCTGCTATCTTGTAAAGAAGGCAGAAGACAACTGGTGGAGCAGACTGATT
AAGCAAGAAGGTAAATCGCCAACGTTTTTGAAAGCTGACTGGGACAAATGGATTGATGAA
GATGAACAGGACAGTGAACCAGCTGGAGCAGATATGGATATGGGTGACATCGACTTTTCG
CAACTCAACATGGGTGGTGGTCTAGGGGATTTTGATGCTGATGAGCCAGAAGAAGATGAA
AGTGACACTGAAGAGGAAATTGAGGAAGGAAAGCATGAACATAGTGAATCTCTAGCAGCA
ACTCCAGCAAGCACTGAAGTTGAGATAAAAGCTTAGAAGCTCTCCCTTTTTTTATGCTTT
TGTTTAACTTCTGATTATTAGTATAAGATATGTTGTTTGAACTAATGTGTCTTGACTATT
GGTGATGGAGCCTATGTTCTGGCTTTGTTATTCAGTGTCTATGCATTTGGGAATTTAACT
TGAGATAAAGTAGAACAATGGTATCATTCTTGGTTAAATGAAGTAATCTGTGATTTGAGG
GTCATGGGTTGAGTTTTATTCTCAAAATTTTCACTTGCCATAGACCGGTGACCTAAGTAG
GATTTTTTGCAAGAAATAAGCGCACACAACTGTTGTCTGTTTTTCGAAAATCTTGTTTTT
GTTAAAC