Microarray Probes on PGSC0003DMT400043603

Probe IDChipProbe Sequence
CUST_21817_PI426222305 JHI_St_60k_v1 CATGGAGGTGCAGGGGAACTTTTTTAACATATTATCTTCCTATTTAGTTGAACTTCCATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043603

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043603 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G36100.1 +3 2e-13 70 33/68 (49%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65090.3); Has 57 Blast hits to 49 proteins in 15 species: Archae - 0; Bacteria - 4; Metazoa - 6; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | chr5:14191711-14193654 REVERSE LENGTH=295

Transcript Sequence (1187 bp)

>PGSC0003DMT400043603 1187 pgsc_dm_v3.4
TACTGTGATTATCATAACCGATGATTCAAATTGTAGAATCCATGCTAATGTTGCATTTTT
TGAACATGTCTTGCTCCTACAATTTTTGATACTGGTATGTGTGATATCAAGGTTAGTCCC
TCTTTTTCACTTAAAGAGGTTGTCGCGTGCTATAGTTTTATCCGTGATGGAAGGCAAGAT
GCACGAACACTTTTCTCTCCCATGTTCGATTTTTCATATCTGGTCTCCTTTGTACTAACT
GCTTGTAATATTCATTTATTTCATTCTGTGGCTAGAGTATTTGAAGCCATTTGGATTCAT
TTTTACTTGCTTGATGATATTGCTAGGAGTTCTCCAGTGAGGAGAAGATATGGGAGAAGA
TGAACGCAATGAGAACAATCGTGGGATACACAGTAGCCACTCAACCTTTGTTGGTAGATG
AACTAAAGGCGCTATACATCTTTACTGGAGTCGAGCCCCCATCTACGTTCCATAACCCGT
CCACTTTGGAAGAAGTGAATGACAAGCTTCAGTTTCTTATGTCGATTGTGGGAATAAAGT
AAAGTGCTAGAACGTACTTTGTTTGGTCTGTATTTTCTTATCGTCTACTTTTGTCTTGTT
AGTTTGTCAAATTTTAGCTTGATACTGGATTTGTGTATGATTATGCTAGAAATTGCACTT
CGTTGTAAATCATCAACTTGAATGTTCAACAGAGTTTTGGCTCCTTTTAGGAAAATGTTC
TCTTATGCTTGAACGTTGCTCTATCTTGGTGGCGTCGGTTCTGGAACAGGAACTGCTGTT
CTTGTTGATGTTTTTGAAGACTCACTGTTGTGCAGTCTTTGAATTCTGAATGTGATCTTA
GCCAAGTCTCTTATTGTCTTCCAGTTGATTGGCTTCTCGTGGACTGCCCCGAGTTTCGAG
TTTGTGTCTTGGCATTTCAGCTTTTTCAATAGAATATTGGAGTTTCCACAAGGCAATGGT
GTATTGAGCCAGATGTCGAAAAGCAACTGATCTCGGTGTACAGAGTGAGATGTCGAACTT
CATGGAGGTGCAGGGGAACTTTTTTAACATATTATCTTCCTATTTAGTTGAACTTCCATA
TTTCATGTTAAGTATATAGTACTTTATTTTATCATATTATTAATTCCTGTATGAATTCCA
AAAGATGAAGAAATTGAAGAAAATGGTACTCCTCATTCAAGTTGTGT