Microarray Probes on PGSC0003DMT400043513

Probe IDChipProbe Sequence
CUST_49100_PI426222305 JHI_St_60k_v1 TTGGACATGTCGTGCAGCTATTGATCGAAGCTATTGGGTATTTTGGATTGCCGGTTCTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043513

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043513 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G19390.1 +2 1e-38 141 66/179 (37%) Uncharacterised protein family (UPF0114) | chr4:10574903-10576355 REVERSE LENGTH=273

Transcript Sequence (1136 bp)

>PGSC0003DMT400043513 1136 pgsc_dm_v3.4
AAAAAAAGTAAGAGAGAAAAATAAATAAAAGAAGGTGAAATTAATTAAAATGGCGGTAAA
TGGTAGATTGTTACGTACCTCTAAGCAAATGGGGTTACGTGACAACAATGGTGGCCAGAA
TCAGCAGCAGCAACGTTGTTATTCGTTGATGAATAATTATTCGTTAAAGTTTAAGTGTTT
AAACAAAGGTGGCCTTGTTGGCGGAGCAGAGAAGAAGACAGTAGCAACTAAGGCTGTTGG
TACTGCGGTTGTGTCTGAACCAATTACGACACAAAATTGGAAGATTTCAGATCTAAGTTT
AATCGCAGATAATAATGTATCAGATCTGATACTTCAAAACTTGAAAAATTTACTCAAACA
AATGCCGCAGAAATTGCATCACTTACAGTCTTCCATAGAGAAGGGTATTTTGGATTGCCG
GTTCTTCAGTCTTTTTGCAGTCGCAGGGACATTGATTGGTTCATTATTATGCTTTATCGA
GGGCTGTTACTTAATCATAGAGTCATACGTCCACTATTTTATCGCACTCTCACATAAGTC
AGACCTTGGACATGTCGTGCAGCTATTGATCGAAGCTATTGATATGTTTCTATTGGGGAC
TGCTATGCTTACATTTGGAATGGGATTGTATGTCATGTTTGTGGGATCAAGAAATATTAA
TGTTAAAAGAGATGATCAAATGTCAGGCAAAAAGTTGTATTATTTTCAAACACTTCCATC
ATTGATGGGAATGAAATCAGTAATGCAAGCCAAATCAAGAATAGGACATGCACTTATAAT
GTTACTTCAAGTGGGAGTATTGGAGAAGTTCAAGAATATACCTGTAGTTAATGGATTGGA
TCTTGCTTGTTTTGCTGCTGCTGTTTTTGTTTCCTCCATATGTGTCTTCATTCTTTCTAG
GCTTGCTGTCACTAACACAAAGGCTGGAAACTAAGATAATTCATTTGTAACCAAAAAAAT
AGGTCTGTATACTAGTCGAAAATTAGGACTTGTTATAGTTGACCTTATTATTAAATATTC
TTTCAATTTGTAACAATTAAAATACATTTGTTCATATCTGTTTTTGTATATTTTTCGAAT
CAGTAAATGAGTTTCTGATATGGTCCCCAGTTATGGATCTAGTTATGAGACGCTGC