Microarray Probes on PGSC0003DMT400043510

Probe IDChipProbe Sequence
CUST_49115_PI426222305 JHI_St_60k_v1 GAAAAATTTACTCAAACAAATGCCGCAGAAATTGCATCACTTACAGTCTTCCATAGAGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043510

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043510 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G19390.1 +1 3e-29 87 39/113 (35%) Uncharacterised protein family (UPF0114) | chr4:10574903-10576355 REVERSE LENGTH=273

Transcript Sequence (1258 bp)

>PGSC0003DMT400043510 1258 pgsc_dm_v3.4
AAAAAAAGTAAGAGAGAAAAATAAATAAAAGAAGGTGAAATTAATTAAAATGGCGGTAAA
TGGTAGATTGTTACGTACCTCTAAGCAAATGGGGTTACGTGACAACAATGGTGGCCAGAA
TCAGCAGCAGCAACGTTGTTATTCGTTGATGAATAATTATTCGTTAAAGTTTAAGTGTTT
AAACAAAGGTGGCCTTGTTGGCGGAGCAGAGAAGAAGACAGTAGCAACTAAGGCTGTTGG
TACTGCGGTTGTGTCTGAACCAATTACGACACAAAATTGGAAGATTTCAGATCTAAGTTT
AATCGCAGATAATAATGTATCAGATCTGATACTTCAAAACTTGAAAAATTTACTCAAACA
AATGCCGCAGAAATTGCATCACTTACAGTCTTCCATAGAGAAGGGTATTTTGGATTGCCG
GTTCTTCAGTCTTTTTGCAGTCGCAGGGACATTGATTGGTTCATTATTATGCTTTATCGA
GGGCTGTTACTTAATCATAGAGTCATACGTCCACTATTTTATCGCACTCTCACATAAGTC
AGACCTTGGACATGTCGTGCAGCTATTGATCGAAGCTATTGGTACATTTTCCCTCTCTTA
AACGTTGAAATTAATAATCGAGAATTGAATGAACAAGTGTTTATATTATGAGCATAAAGA
AGTTAAACTGTAATTGAATAACGTTCTTTTTTTTTTTCTTCAGATATGTTTCTATTGGGG
ACTGCTATGCTTACATTTGGAATGGGATTGTATGTCATGTTTGTGGGATCAAGAAATATT
AATGTTAAAAGAGATGATCAAATGTCAGGCAAAAAGTTGTATTATTTTCAAACACTTCCA
TCATTGATGGGAATGAAATCAGTAATGCAAGCCAAATCAAGAATAGGACATGCACTTATA
ATGTTACTTCAAGTGGGAGTATTGGAGAAGTTCAAGAATATACCTGTAGTTAATGGATTG
GATCTTGCTTGTTTTGCTGCTGCTGTTTTTGTTTCCTCCATATGTGTCTTCATTCTTTCT
AGGCTTGCTGTCACTAACACAAAGGCTGGAAACTAAGATAATTCATTTGTAACCAAAAAA
ATAGGTCTGTATACTAGTCGAAAATTAGGACTTGTTATAGTTGACCTTATTATTAAATAT
TCTTTCAATTTGTAACAATTAAAATACATTTGTTCATATCTGTTTTTGTATATTTTTCGA
ATCAGTAAATGAGTTTCTGATATGGTCCCCAGTTATGGATCTAGTTATGAGACGCTGC