Microarray Probes on PGSC0003DMT400043223

Probe IDChipProbe Sequence
CUST_48349_PI426222305 JHI_St_60k_v1 GAAAGAGAAAGATCTCTACTTAATCGCCAAAACGAATCAAAGTTTGGATATCATGCTCTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043223

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043223 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G26210.1 +1 9e-90 283 156/400 (39%) cytochrome P450, family 71, subfamily B, polypeptide 23 | chr3:9593329-9595202 REVERSE LENGTH=501

Transcript Sequence (1191 bp)

>PGSC0003DMT400043223 1191 pgsc_dm_v3.4
ATGTACAATAATAAAGATATTGCATTTGCAGAATATGGTGACTACTGGAAACAAATGCGC
AAAATTTGCATAATGGAACTTCTAAGTGCCAAGATGGTCAAGTCATTTAGCTCAATTCGA
AAGGATGAACTCTCGAGTGTTCTCTCATCAATGGATTCTGTTGGGGGTTCTTGTGAAGTG
AACATGACGGAAAAAATTGTTCGATTCACGAGCTCTGTGACATGTCGATTGGTGTTTGGG
AAATTGTGCAGAGATCGTGATGAGTTGATAAATTTGATGAAAGATGCGTTGTTTTTAGTA
GGAGGATTTGATGTAGGTGATTTCTTTCCATCGTGGAAGTTACTTTACAAGATGAGTGGA
GCAAAGTCGAAATTGGTAAAAATGCATCAAAACATTGATTTAGTTTTGGAGAGGATTGTT
AATGAACATATTAAAAATCGAGTAGCGGGGATCAAGGGAAATGGTGCCTATGGAGGTGAA
GATTTGGTTGATATTTTCCTAAGAATTAAAGAGAATGATCAACTTCAATTTCCAATCATC
AATGACCACATAAAAGCTGTGATTTTGGACATGTTTACTGCTGGGACTGAAACATCATCC
ACCACTATTATTTGGGCATTGTCAGAATTGATGAAACACCCAAATGTTATGGCAAAGGCA
CAAAGTGAAGTGAGACAAGCCTTCAAAGAGAAAATTGATTTTGATGAAGAAGATCTTGAT
AACTTGCCGTATCTAAAGTTAGTTATCAAAGAAACATTAAGGCTACACGCTCCAAGTATA
GTCCATAGGGAATGTCGGGAAGAAACAATTGTTGATGGATATACAATACCTGCTAAGGCC
ACAGTACTGGTCAATACATGGGCAATGGGAAGAGATCCTGAAGTTTGGGATGATCCCGAA
AGTTTTATACCAGAGAGATTTGAAAATTCTCCTATTGACTATTTGGGAAATAACTATGAG
TTTCTCCCATTTGGCGCAGGAAAAAGAATTTGTCCAGGAATGCAGTTTGGTTTAGCTAAT
GTTAAACAACCTCTAGCGCGGCTCCTCTACCACTTTAACTGGGGTCTTCCATGTGGAATA
AATACTCCAAAAGATTTGGATATGAGTGAAAAAAGTGGATTAAGTGCAGCGAAAGAGAAA
GATCTCTACTTAATCGCCAAAACGAATCAAAGTTTGGATATCATGCTCTAA