Microarray Probes on PGSC0003DMT400043200

Probe IDChipProbe Sequence
CUST_48329_PI426222305 JHI_St_60k_v1 GGAGAAAGAAAAAAGATGTCTTTTTTCCCCTCTCTTTTTGTAACTAGTATCTAGGAAGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043200

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043200 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G32240.1 +2 5e-83 269 208/422 (49%) Homeodomain-like superfamily protein | chr1:11625882-11630355 REVERSE LENGTH=388

Transcript Sequence (1894 bp)

>PGSC0003DMT400043200 1894 pgsc_dm_v3.4
GTCCACAAAAAGGAACAATCTCCTCTCTACTCCCTACACCCCCTTACCCTACATTAGCCT
CTCAAAGTGTCATTTTCTCACATATACTTCACACAAAAGAAACAACCATTCACTTCATCT
TCATCCTTTGTCATTTCTCTCTCTCTAAAACTCAATCTCAAATTCCTTCTTACTACTACT
ACTACTACCTTTCATTTGATCAACACAAGAAACAACAACAACATAAATTGCTAGTAAGCG
CAACGCACTTGGGCAAAGAAAGAGAAGAAGTATATATATGGAGCTATTCCCAGCACAACC
AGACTTATCTTTACAAATAAGTCCTCCAAACAACAAATCATCATCAACAACAACAACATG
GAAGACAACGAGTAGTAATAATAACAATACTGATCGAGATGAGATGAACTTATTCTTCTT
GAGAAGAGCTTTAGAATCAAAACCTGATAACAACAATACTCTTTTTGGGCTTTCTTTATC
TAATCCTAATTATAAACCTTCTCATACTCAGTTAATTAACTCTTCCCATTTCCATCCCCT
CCAAAACAACAACTTCATCCACCAACAAAATCAACAACAACAACTTAGTTTCTTGAGACC
TATAAGAGGAATTCCATTGTACCATCAAAACCCTCTTCCTCTTTCTCATCATCATAATAA
CTACCCAATATTTGCTCACCAAACCTTTGAAAATACTACTACTACTACTGCTACTGCAAC
AACACCTACATTACCTATACATTCTTCTGGTTATTGTATTACTAGTTTTAATAACAATAG
TAACAAAACTATACCTAATTCCTCACCAACAACTATCCCTTTTCATCACTCTAATCATCA
AGGTGGGCTAATGCGATCTAGATTTTTATCAAGGTTTCCTAAACGTACCATGAGAGCGCC
ACGTATGCGATGGACTAGTAGTCTTCATGCCAGATTTGTTCATGCTGTTGAGCTCTTGGG
TGGCCATGAAAGAGCAACACCCAAATCAGTTCTTGAGCTAATGGATGTGAAAGATCTCAC
TTTGGCACATGTTAAATCCCATTTACAGATGTATAGGACGGTTAAGACTACTGATAGAGC
AGCAGTTCCAGCTTCTTCAGGCCAATCTGAGGTATTCGATAATGGGTCTTCTGGGGAAAC
TTCAGAGGATTTAATGCCTGACATGGAAAATTCAAGAAAGTCTGATTTATCTGATCAACA
AGGCAAAAATAGTATGCATCTTCAAGAGATAGATTATCATGGTCTTTGGAGCAACTCTTC
AAGCAGAGAAAGTTGGCAGCTGCATGGCAAACATGGTGACTACCCTGGGAACATCCCATC
TCTTGAGAAAACAGTGAAAAATCAGCATATAGATTTGGAAGCAAAATGTTTAAGCTATGA
TAGATTATCAGGAGAAGTGAGCTCTTCAAGCATAACAGAGACAAGTCCAAAGAAGCCTAA
TTTGGAGTTCACTTTGGGAAGGCCTTCAGAGTAAAATAAAATAAAATAAAATTGCATGCA
GATAAGTTATTAGTACTCATTTTGAAATCATTATAATTTCTGACAAGGCAAAAGCAAAAA
AAAAAGGTAACAATAGAATCAGGTGCCCACAAGAAGAGAAAAAAGCAAAAGAAAGACAAG
GAGACAAAAAAAAGAGAGGAAGAAGGCACAAGGAGAAGGAGGGGAAAATATGTGAGTCCT
CTACATCAAACAATATCTTATTTTATTCCTTTCTAGAGAGAGAATATGAAATCTAATTGA
TTTTGTGTATTATTAGAGTAGTCATTAGAGGGAGAAAGAAAAAAGATGTCTTTTTTCCCC
TCTCTTTTTGTAACTAGTATCTAGGAAGTGATCTTTTAATTATCCTTGGTAATTGTATGA
CTCACTTTATTATGTTTTAAAGAAAAGAAATGGC