Microarray Probes on PGSC0003DMT400043146

Probe IDChipProbe Sequence
CUST_12218_PI426222305 JHI_St_60k_v1 TAATCTATTGGGATGGTGCAAGAGTTCTTGGAGTTTTGGCTATGTCTCGAGCAATCGGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043146

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043146 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G11410.1 +3 6e-143 422 233/406 (57%) protein phosphatase 2CA | chr3:3584181-3585649 REVERSE LENGTH=399

Transcript Sequence (1662 bp)

>PGSC0003DMT400043146 1662 pgsc_dm_v3.4
ATTTCTTAATACTGCTTGTTTCGTCTTATTGTTTCCTTGAATTTATCAGTTGTTGATGAA
TTCGGTAAAGTTTTAGCGATTGGTTGATCAAACACACAAGAAGAAGAGTGAGTGTTTTAT
ACGATTTTCTTTTTAATTGCGGAATGTCTTTTGGTGAGACTAAAACTGTAACTCCAACTG
AACCGAGTACGGAAGCTGCAAGAAGGAGACGCATGGAAATTCATCAGTTTCGATTTGTTG
CCAGCGATATGGCGGTGGCTCCACCGACTAGTATGGAGAATGGAGGAAGGAAGAGACAGA
AATTGGAGAAAACTGTGTCGGTAAAAAGCTATGATAGTAAAGAGAAGAAGCGATTCAAGT
TGGAAAGAATTGTTTCCCTGCCACTATCGCTGCCGTGCACAAGTGAAATTGAGATGGGTA
AAAAGAAGTTAGCAGAGAATAAAGAAACCGAAACGAACGCTTTGGATTTGACGGAATCTG
CTTCTATATCGTTGAATATTGAACGCCAGGGAGTATCCGACTGTCCAAAATTCGGGATGA
CATCTGTATGTGGAAGGAGAAGAGATATGGAAGATACGGTGTCGATCTACCCGTCGTTTC
TTCAGGATAAACATGAAAAGTCCAGCAACTTACATTTCTTCGGTCTCTACGACGGCCACG
GCTGCTCTCATGCGGCGATGAAATGTAAAGATAGAATGCATGAGATAGTGAAGAACGAGG
TTGAGAGCGCAGGGGAAGCTACATGGAAAGAGATGATGAGTCAGAGCTTCTCAAAAATGG
ACAAAGAAGTCGTTGAATATTCGAAAGGAGCTGGAGGCACACATACTGTGGATTGTAGAT
GCGAACTTCAGACGCCGCAGTGCGATGCTGTTGGATCCACTGCTGTTGTGGCCGTCCTAA
CTCCAAACAAAATCGTCGTGTCCAACTGCGGTGATTCTCGCGCTGTGCTCTGCAGAAACG
GTATCCCAATTCCTCTGTCCACTGACCACAAGCCTGATCGACCCGATGAACTCAATCGGA
TTGAAGAAGCTGGCGGTCGTGTAATCTATTGGGATGGTGCAAGAGTTCTTGGAGTTTTGG
CTATGTCTCGAGCAATCGGTGACAGTTACTTAAAACCATATGTTACATCTGAACCGGAGG
TGACCATAACGGAGAGAACAGTAGAAGATGAGTGTTTGATATTAGCGAGCGACGGGCTAT
GGGATGTTGTCTCAAACGAGACAGCATGTGGTGTAGCTCGCATGTGCTTGCGATCTGGGC
AGAGCTCCGACCAGGCTTGCACTGATGCGTCAATCCTCTTGACAAGGCTGGCTTTGGCTC
GGCACAGTTCGGATAATGTTAGCGTTGTCGTCGTTGATTTGAAAGGAGGTCTATAAGGGA
TTGATTTAATTATAAGTTTTGCATGTACATGTACTTGTGTTTTTCTTTATAGGCAAGATT
TTCCACGGTTGGTTCCTGGGATGCAACTCTCCCAAGGAAGGGAAACTGCTTGAGCTGGAG
AGAGTCTGTTGTATTACTAAGTAGGTGTTCTGGACATCGGAAACAGATCGCCCTACTTTG
ATTTTTGCAGGCTTTGTTTTCTGCTCAATTGGTTTGTTTTTATTGTGTTAAAAGTTTTTG
CATATTTATTGGAGAAGAAACTTCTAAACGTAGGGATACAAA