Microarray Probes on PGSC0003DMT400043098

Probe IDChipProbe Sequence
CUST_18471_PI426222305 JHI_St_60k_v1 CTACTACCTACTCTGAAGAGTTTTGCATAGTCACAAGCAAATTTTCTCCAGAATTTAAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043098

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400043098 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G65900.1 +1 0.0 532 258/399 (65%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 306 Blast hits to 306 proteins in 119 species: Archae - 19; Bacteria - 238; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). | chr1:24516023-24518325 REVERSE LENGTH=408

Transcript Sequence (1534 bp)

>PGSC0003DMT400043098 1534 pgsc_dm_v3.4
ATTACACTGATAGATTGATTATATTTTTAGAAAGTATTATAAGTGTTAGCATTTCTTTCA
TCCCTTCACTCAATCCCCTAGCCTAATTTTGTCATTGTATGTACCATAAATATGTATTTA
CTCTCACATTTTTCTACTAATTTGTGTGTGGTGCAAATTTTGTTTGTTTTGTTGTGGTGC
ATCCAGAGTTTAGAGTATGCAAATGCAGCAACTCCAACAGTGAAAGTTGGGAATATATCA
AAAGTGGGAGATTCTGCATATTTTAGGATATACTATGGACAAACCTTCAAAGTTATTAAG
AACACCCTTGATGGAAAGAGTTATCTTCTTATCCAGAACAACACAAGAATGGCCAGTAGA
ACAAAATATTGCACCTCAAGAATAAAGTCTTTTGTTATCCCACTAGCAAACTACTCGATC
GAGACTGACTACTTTTTTCCAGTTTCCTTTTTCGAGCTACTAGGCCTACTGGGAAACTTG
AAAGGTATCACATCAACATATGTGGCCTCCCAATGTGTACTAAAACTATACCAGGGCGGA
CAAGTGGAGAGCATTAACAAGACTGACCATCAACAACTTGCACAATATGCAGCTCACTTC
ATCGCCAACACGGATGAAGCTCAACCCTGCAACTTTGCCACATTTGTCCCTATAGGTGAA
GATGCACCTCTCCAGCGTGCAGAGTGGATAAAATACTTGGGAGTTTTTGCCAATATGGAA
AACAGGGCAAACCAAGTTTACGATGCAATTAAGGAGAATTATTTGTGCTTGAGCAAAGCT
GCAACTAGTAGGAATTCATTAAAACCAGTTGTCTCTTGGATGGAGTATAAAGATGGAGTG
TGGTCATTTACAAGAGATCCATACAAATTAAAGTTTGTAGAGGATGCTGGTGGAGTCAAT
GTTGATGATTCCATCAACAAAGTCACATACAATATGTCTAATCCTGATGATTTGGAAGAG
ATTCATGCCATTTTGTGTACTGTGGATGTAGTGATTGATGAAACATATAGCTCAGATCCA
GCGGTTTATAATGGTTCCACATTTCTCGGAAACATCAATTTGGAAGATCAAACTTGCTTT
GCTTTTCTCACAAATCAAAGCATATGGAGATATGATAAAAGAGTGCAAAATTCTGTAGTC
CTCGACTGGTATGATGGAGCTGTCTCTCAACCCCAACTGGTCCTATCAGATATTATTGAA
GCTTTATATCCTACAGGAAATTATAACACTACATATTTCAGAAATATCGCAAAGGGAGAA
GGGATCATAAGCATTGGTCCTGAAATGTGTGAAAGAGATAGCTCTATCCCAATGGAACCT
ACAGTTGTAGCTTGCCAGTAACTAGCAATTCTTTCTCATGATTTTTAGCTTCTTTTTTCT
AGTCGCACTTTGGCCTGTCAATTGATCTGCTATGATTAGATTCAAACGGAAAACCAATTT
ATTCATCAGTAAAGTCGAAGTCAATGGGGCTACTACCTACTCTGAAGAGTTTTGCATAGT
CACAAGCAAATTTTCTCCAGAATTTAAGTTAAAC