Microarray Probes on PGSC0003DMT400042944

Probe IDChipProbe Sequence
CUST_35876_PI426222305 JHI_St_60k_v1 ATTCTACTTTTGCTGATTATGGAGGATGGCAAACTGCTCATGCCACTTTCTATGGAGGGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042944

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042944 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G40610.1 +3 3e-108 322 187/228 (82%) expansin A8 | chr2:16949121-16950472 REVERSE LENGTH=253

Transcript Sequence (1158 bp)

>PGSC0003DMT400042944 1158 pgsc_dm_v3.4
GTCCATAACCCTTAGCTCATATCAATTCCCACTCATCTCTTATCCTCTCCTTAGTTTTAA
TATACTCAATGGCTTCACTTCCACTTGTTTTCTTCTTTTTAAGCTTTTGCTTCTATTCTA
CTTTTGCTGATTATGGAGGATGGCAAACTGCTCATGCCACTTTCTATGGAGGGGGTGATG
CCTCTGGCACAATGGGGGGGGCTTGTGGATATGGAAATTTGTATAGCCAAGGGTATGGAA
CTAACACTGCAGCACTAAGTACAGCACTATTCAACAATGGTTTAACTTGTGGTGCTTGTT
ATGAGCTCACTTGCAACAATGCAGCTCAATGGTGTCTCCAAGGAACTATTACAGTCACTG
CAACTAATTTTTGTCCTCCGAACCCGTCTCTGCCTAACAATAATGGTGGTTGGTGCAATC
CTCCTCTCCAACATTTTGATTTAGCACAACCTGCTTTCTTGGAAATTGCTAAATACCAAG
CTGGTATCGTCCCTGTATCTTTTCGAAGGGTACCCTGTATGAGAAAAGGAGGAATAAGGT
TTACAGTAAATGGACACTCTTTTTTCAACTTGGTTTTAGTGACAAATGTTGGAGGTGCTG
GTGATATTCAATCAGTTTCAATTAAAGGGTCCAATACTGGATGGCAAGCAATGTCAAGAA
ATTGGGGCCAAAATTGGCAAAGCAATTCTAATCTAAATGGTCAAAGTCTTTCATTTCAAG
TCACTACAAGTGATGGAAGGACACTCATTAGCAACAATGCTGCACCAACTAATTGGCAAT
TTGGACAAACTTTTGAAGGGGCTCAATTTTAATTAATTAATTTACTATAAGCACAAATTG
AGGGGTTTTCAACTTGTAATTTGTATATGGCATGAAAGGGGTGAGTAGGTTTGGGAGAAA
ACTCCCTCATGGTGGGGAGTTTGGCTCTATTGCTGTGGTGGCTGGTTTGCACCCGCTTAG
GCCTATTAGTAATTTTTATTTTTTTTACAATTTTAGGGATATTTGATTAGTGGCCATTTA
TGGATTTGAAGGTCACTTGAATATCACATAGATTTGTCTATTAGTAGTACCTAATTCATT
GTGTAAGCAGAATTAGGGCAACTTCATGTCATCATGTTATCCTTCTTTATAATTGCTTTG
GTACATTTTCTTCTTCCA