Microarray Probes on PGSC0003DMT400042701

Probe IDChipProbe Sequence
CUST_43211_PI426222305 JHI_St_60k_v1 TTTAGACGAGGCGGAGTACACAATTGTAAAGAACATCATACAGATTGAATACTACTCTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042701

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042701 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G29500.1 +2 8e-33 117 67/122 (55%) SAUR-like auxin-responsive protein family | chr1:10321290-10321697 FORWARD LENGTH=135

Transcript Sequence (634 bp)

>PGSC0003DMT400042701 634 pgsc_dm_v3.4
GCATTATCAGTTCAACCATCAAAGGTCTCTAAATTTCTTTTCTACTTTTCTCATTTTCAA
TCTTCCAAAAAAACAAATGGCAATGCTCAGCGCTAAGAAACTCATCAAGATGGCCAGGAA
ATGGCAGAAGTTTGCAGCTATGCAGAGGAAGAGGATTTCATCATTTCCAAGAAATGCTAG
TGATGCAGACAGTTGCAGTACGTCTTCATCCTCTATAGTTGAAAAAGGCCGTTTTGTAGT
ATATACAACTGATCAAGCCCATTTTGTCGTTCCCTTGGCTTACCTTGAAAATGAGGTCAT
TAGACAACTTTTAAGCATGTCCGAAGAAGAGTTTGGGTTGCCAAGTGGTGGCCCTATTAC
ATTACCCTGTGATTCAGCCTTGATGAGTTATATCATTTCACTAATCAAGAGAGGTGTAGC
TGCTGGAGATCTTCACAAAGCGTTGCTCTTCTCAATTCCTTCATGTTGCTCTTCAACTTC
TTCTTTGCACCAAGAAAGTGGAAGCCAACAGCTACTTGTTTGTTGAGTCAAGGCCAACAT
TCTTTTTGTAAATGCTAGCTCAAAAATAGTCTTTAGACGAGGCGGAGTACACAATTGTAA
AGAACATCATACAGATTGAATACTACTCTATTTG