Microarray Probes on PGSC0003DMT400042700

Probe IDChipProbe Sequence
CUST_43214_PI426222305 JHI_St_60k_v1 AAGCCGACAGCTTCTTGTTTATTGAGTCAAGGACAACATAATTTTTGTAGATGCTAGTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042700

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042700 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G29430.1 +3 4e-35 123 73/146 (50%) SAUR-like auxin-responsive protein family | chr1:10302801-10303226 REVERSE LENGTH=141

Transcript Sequence (597 bp)

>PGSC0003DMT400042700 597 pgsc_dm_v3.4
GTTCAACCATAAAAGGTCTCTAAATTTCTTGCTACTTTCTTATTTTCAATCTTCCAAAAA
AACAAATGGCAATGCTCAGCGCTAAGAAACTCATCAAGATGGCTAGGAAATGGCAGAAGT
TTGCCGCTATGCAGAGGAAGAGGATTTCATTTCCAAGAAATGCTAGTGATGTAGACAGTT
GCAGTGCATCTTCATCCTCTATAGTTCAAAAAGGCCATTTTGTAATCTATACAGCTGATC
AAGTCTGCCTCGTCGTTCCATTGGCTTACCTCGAAAATGAGGTCATTAGGCAACTTTTAA
GCATGTCTGAAGAAGAGTTTGGGTTGCCAAGTGGTGGCCCTATTACATTACCCTGTGATT
CAGCCTTCATGAGTTACATTATTTCACTAATCAAGAGAGGTGTAGCTGCTGGAGATCTTC
ACAGAGCAGTGCTCCTCTCGATTCCTTCATGCTGCTGTTCCATTTCTTCTATGCACCAAG
AGAGTGGAAGCCGACAGCTTCTTGTTTATTGAGTCAAGGACAACATAATTTTTGTAGATG
CTAGTTCAAAAATAGTATTCAGAGAAGCAGACATCTAAAAGTACACAATTGTATAGA